Incidental Mutation 'R8964:Sod3'
ID 682597
Institutional Source Beutler Lab
Gene Symbol Sod3
Ensembl Gene ENSMUSG00000072941
Gene Name superoxide dismutase 3, extracellular
Synonyms EC-SOD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8964 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 52363791-52371418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52368354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 132 (F132I)
Ref Sequence ENSEMBL: ENSMUSP00000098768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101208]
AlphaFold O09164
Predicted Effect probably damaging
Transcript: ENSMUST00000101208
AA Change: F132I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098768
Gene: ENSMUSG00000072941
AA Change: F132I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sod_Cu 85 224 1.5e-32 PFAM
low complexity region 233 251 N/A INTRINSIC
Meta Mutation Damage Score 0.3547 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen, which may protect the brain, lungs, and other tissues from oxidative stress. Proteolytic processing of the encoded protein results in the formation of two distinct homotetramers that differ in their ability to interact with the extracellular matrix (ECM). Homotetramers consisting of the intact protein, or type C subunit, exhibit high affinity for heparin and are anchored to the ECM. Homotetramers consisting of a proteolytically cleaved form of the protein, or type A subunit, exhibit low affinity for heparin and do not interact with the ECM. A mutation in this gene may be associated with increased heart disease risk. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to hyperoxia, increased LPS-stimulated spleen production of TNF, and enhanced severity of collagen-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik C T 7: 131,138,987 V167M probably benign Het
Abca6 G A 11: 110,248,537 P37L probably benign Het
Abca9 A T 11: 110,147,249 Y490* probably null Het
Abcb11 A G 2: 69,286,717 V529A possibly damaging Het
Acox2 G T 14: 8,243,768 Y529* probably null Het
Adck2 G T 6: 39,574,149 probably benign Het
Agxt T A 1: 93,145,147 C409S possibly damaging Het
Ahsa1 T A 12: 87,271,357 I164N probably damaging Het
Arhgef1 A G 7: 24,923,037 E647G probably damaging Het
Axin1 T G 17: 26,142,744 F21V probably damaging Het
B3galnt1 A G 3: 69,575,256 I224T probably damaging Het
Bche T C 3: 73,701,073 K340R probably benign Het
Bpifb5 T A 2: 154,230,278 W302R possibly damaging Het
Cd72 G A 4: 43,450,218 T230I probably damaging Het
Cdc42ep4 T A 11: 113,729,452 M38L probably damaging Het
Cdcp1 G A 9: 123,183,496 Q329* probably null Het
Clps C A 17: 28,558,756 probably benign Het
Cluap1 A G 16: 3,911,470 probably benign Het
CN725425 C T 15: 91,235,769 S31L possibly damaging Het
Cnbp T C 6: 87,844,104 N158D probably benign Het
Crebbp A G 16: 4,091,889 F1545S probably damaging Het
Cyp39a1 A T 17: 43,691,667 T258S probably benign Het
Dclk2 T C 3: 86,836,391 D257G probably damaging Het
Dock7 A T 4: 99,061,239 D455E Het
Ehbp1 G A 11: 22,151,154 Q259* probably null Het
Eif3a A T 19: 60,763,192 D1228E unknown Het
Gm498 A G 7: 143,869,293 T39A probably benign Het
Has2 A T 15: 56,667,665 D551E probably damaging Het
Herc1 T A 9: 66,445,590 N2119K probably damaging Het
Hsdl1 C T 8: 119,566,160 A179T probably benign Het
Htt T A 5: 34,905,376 M2818K probably benign Het
Il18bp A G 7: 102,016,384 S80P possibly damaging Het
Ints10 A G 8: 68,811,979 M455V probably benign Het
Ipcef1 T C 10: 6,919,789 T255A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrba T A 3: 86,351,245 D1346E probably benign Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Met C T 6: 17,527,145 P532S probably damaging Het
Nlrc5 T A 8: 94,505,488 M1314K possibly damaging Het
Notch1 A T 2: 26,481,050 S341R possibly damaging Het
Nr3c2 T G 8: 77,155,312 L670V probably damaging Het
Nuak1 C T 10: 84,374,870 M451I probably benign Het
Nubp1 G A 16: 10,421,030 V170I probably benign Het
Olfr1014 T A 2: 85,776,620 I12N probably damaging Het
Olfr110 G A 17: 37,498,773 G41S probably damaging Het
Pamr1 T C 2: 102,634,466 V320A possibly damaging Het
Pcdhb11 T A 18: 37,423,607 N663K probably benign Het
Pcnx G A 12: 81,993,038 G1400D Het
Pdxk A T 10: 78,447,937 V141E probably benign Het
Pex5 A T 6: 124,398,781 N520K probably benign Het
Pklr T C 3: 89,142,729 V337A probably benign Het
Polb T C 8: 22,653,325 D17G probably damaging Het
Ppp1r9b T C 11: 94,991,879 L111P probably damaging Het
Prl3d1 A G 13: 27,099,943 E165G possibly damaging Het
Prpf40a A G 2: 53,145,894 F657S probably damaging Het
Ptgs2 C T 1: 150,105,047 R455C probably damaging Het
Pzp T A 6: 128,487,499 D1355V probably benign Het
Rasl12 T A 9: 65,407,631 V72D probably damaging Het
Rfx2 C A 17: 56,786,696 R266L probably damaging Het
Rnaseh2a T C 8: 84,959,805 D204G probably benign Het
S1pr3 A C 13: 51,419,212 K143T probably damaging Het
Sdr39u1 C A 14: 55,897,713 A258S possibly damaging Het
Sntb2 T A 8: 106,981,176 S191T possibly damaging Het
Sorcs2 C T 5: 36,229,167 V176I possibly damaging Het
Syne1 T C 10: 5,110,872 I7256V Het
Tbc1d22b A G 17: 29,600,228 E459G probably damaging Het
Tbkbp1 A G 11: 97,146,343 S278P probably damaging Het
Thoc5 A T 11: 4,910,647 E245D possibly damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tns2 T C 15: 102,103,118 L11P possibly damaging Het
Trip11 A G 12: 101,845,056 probably null Het
Ttn T G 2: 76,720,965 Y31361S probably damaging Het
Vars2 T C 17: 35,659,807 E678G possibly damaging Het
Vav1 C A 17: 57,299,122 H249N probably benign Het
Vmn2r9 T A 5: 108,848,165 I206L probably benign Het
Vps4a T C 8: 107,045,054 S410P probably damaging Het
Wdr82 T C 9: 106,176,662 Y71H possibly damaging Het
Zfand1 A G 3: 10,348,571 Y19H probably benign Het
Zfp365 A T 10: 67,909,258 I230N probably damaging Het
Zfp763 T C 17: 33,021,736 T40A probably benign Het
Zfp788 A T 7: 41,647,579 D51V probably damaging Het
Other mutations in Sod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Sod3 APN 5 52368198 nonsense probably null
IGL02894:Sod3 APN 5 52368006 missense possibly damaging 0.70
R0646:Sod3 UTSW 5 52368079 missense probably benign 0.02
R1822:Sod3 UTSW 5 52368162 missense probably benign 0.07
R1823:Sod3 UTSW 5 52368162 missense probably benign 0.07
R1824:Sod3 UTSW 5 52368162 missense probably benign 0.07
R3872:Sod3 UTSW 5 52368289 missense probably damaging 0.98
R3934:Sod3 UTSW 5 52368645 missense probably benign 0.00
R4969:Sod3 UTSW 5 52368394 missense probably damaging 1.00
R6899:Sod3 UTSW 5 52368708 missense unknown
R7773:Sod3 UTSW 5 52368301 missense possibly damaging 0.94
R9779:Sod3 UTSW 5 52368093 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CAAAGTGCTGGAGATCTGGATG -3'
(R):5'- TGGTTGCCACCTTTACCCAG -3'

Sequencing Primer
(F):5'- TGCCGAGATGCATGCAATCTG -3'
(R):5'- CACAGAGCGGCCCAAGATG -3'
Posted On 2021-10-11