Incidental Mutation 'R8964:Ipcef1'
ID 682622
Institutional Source Beutler Lab
Gene Symbol Ipcef1
Ensembl Gene ENSMUSG00000064065
Gene Name interaction protein for cytohesin exchange factors 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8964 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 6885796-7052478 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6919789 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 255 (T255A)
Ref Sequence ENSEMBL: ENSMUSP00000077215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052751] [ENSMUST00000063036] [ENSMUST00000078070] [ENSMUST00000086896] [ENSMUST00000105601] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000105617] [ENSMUST00000123861] [ENSMUST00000129221] [ENSMUST00000129954] [ENSMUST00000135502] [ENSMUST00000144264] [ENSMUST00000145156] [ENSMUST00000147171] [ENSMUST00000154941] [ENSMUST00000170680]
AlphaFold Q5DU31
Predicted Effect probably benign
Transcript: ENSMUST00000052751
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078070
AA Change: T255A

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077215
Gene: ENSMUSG00000064065
AA Change: T255A

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 150 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
Blast:PH 286 343 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000086896
AA Change: T204A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084110
Gene: ENSMUSG00000064065
AA Change: T204A

DomainStartEndE-ValueType
Pfam:PH 3 65 7.4e-8 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105611
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105615
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105617
AA Change: T251A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101242
Gene: ENSMUSG00000064065
AA Change: T251A

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 153 N/A INTRINSIC
low complexity region 242 257 N/A INTRINSIC
Blast:PH 282 339 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129221
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129954
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135502
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144264
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145156
SMART Domains Protein: ENSMUSP00000114267
Gene: ENSMUSG00000064065

DomainStartEndE-ValueType
PH 37 137 5.87e-20 SMART
low complexity region 155 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147171
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154941
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170680
AA Change: T204A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128131
Gene: ENSMUSG00000064065
AA Change: T204A

DomainStartEndE-ValueType
Pfam:PH 3 65 7.4e-8 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik C T 7: 131,138,987 V167M probably benign Het
Abca6 G A 11: 110,248,537 P37L probably benign Het
Abca9 A T 11: 110,147,249 Y490* probably null Het
Abcb11 A G 2: 69,286,717 V529A possibly damaging Het
Acox2 G T 14: 8,243,768 Y529* probably null Het
Adck2 G T 6: 39,574,149 probably benign Het
Agxt T A 1: 93,145,147 C409S possibly damaging Het
Ahsa1 T A 12: 87,271,357 I164N probably damaging Het
Arhgef1 A G 7: 24,923,037 E647G probably damaging Het
Axin1 T G 17: 26,142,744 F21V probably damaging Het
B3galnt1 A G 3: 69,575,256 I224T probably damaging Het
Bche T C 3: 73,701,073 K340R probably benign Het
Bpifb5 T A 2: 154,230,278 W302R possibly damaging Het
Cd72 G A 4: 43,450,218 T230I probably damaging Het
Cdc42ep4 T A 11: 113,729,452 M38L probably damaging Het
Cdcp1 G A 9: 123,183,496 Q329* probably null Het
Clps C A 17: 28,558,756 probably benign Het
Cluap1 A G 16: 3,911,470 probably benign Het
CN725425 C T 15: 91,235,769 S31L possibly damaging Het
Cnbp T C 6: 87,844,104 N158D probably benign Het
Crebbp A G 16: 4,091,889 F1545S probably damaging Het
Cyp39a1 A T 17: 43,691,667 T258S probably benign Het
Dclk2 T C 3: 86,836,391 D257G probably damaging Het
Dock7 A T 4: 99,061,239 D455E Het
Ehbp1 G A 11: 22,151,154 Q259* probably null Het
Eif3a A T 19: 60,763,192 D1228E unknown Het
Gm498 A G 7: 143,869,293 T39A probably benign Het
Has2 A T 15: 56,667,665 D551E probably damaging Het
Herc1 T A 9: 66,445,590 N2119K probably damaging Het
Hsdl1 C T 8: 119,566,160 A179T probably benign Het
Htt T A 5: 34,905,376 M2818K probably benign Het
Il18bp A G 7: 102,016,384 S80P possibly damaging Het
Ints10 A G 8: 68,811,979 M455V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrba T A 3: 86,351,245 D1346E probably benign Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Met C T 6: 17,527,145 P532S probably damaging Het
Nlrc5 T A 8: 94,505,488 M1314K possibly damaging Het
Notch1 A T 2: 26,481,050 S341R possibly damaging Het
Nr3c2 T G 8: 77,155,312 L670V probably damaging Het
Nuak1 C T 10: 84,374,870 M451I probably benign Het
Nubp1 G A 16: 10,421,030 V170I probably benign Het
Olfr1014 T A 2: 85,776,620 I12N probably damaging Het
Olfr110 G A 17: 37,498,773 G41S probably damaging Het
Pamr1 T C 2: 102,634,466 V320A possibly damaging Het
Pcdhb11 T A 18: 37,423,607 N663K probably benign Het
Pcnx G A 12: 81,993,038 G1400D Het
Pdxk A T 10: 78,447,937 V141E probably benign Het
Pex5 A T 6: 124,398,781 N520K probably benign Het
Pklr T C 3: 89,142,729 V337A probably benign Het
Polb T C 8: 22,653,325 D17G probably damaging Het
Ppp1r9b T C 11: 94,991,879 L111P probably damaging Het
Prl3d1 A G 13: 27,099,943 E165G possibly damaging Het
Prpf40a A G 2: 53,145,894 F657S probably damaging Het
Ptgs2 C T 1: 150,105,047 R455C probably damaging Het
Pzp T A 6: 128,487,499 D1355V probably benign Het
Rasl12 T A 9: 65,407,631 V72D probably damaging Het
Rfx2 C A 17: 56,786,696 R266L probably damaging Het
Rnaseh2a T C 8: 84,959,805 D204G probably benign Het
S1pr3 A C 13: 51,419,212 K143T probably damaging Het
Sdr39u1 C A 14: 55,897,713 A258S possibly damaging Het
Sntb2 T A 8: 106,981,176 S191T possibly damaging Het
Sod3 T A 5: 52,368,354 F132I probably damaging Het
Sorcs2 C T 5: 36,229,167 V176I possibly damaging Het
Syne1 T C 10: 5,110,872 I7256V Het
Tbc1d22b A G 17: 29,600,228 E459G probably damaging Het
Tbkbp1 A G 11: 97,146,343 S278P probably damaging Het
Thoc5 A T 11: 4,910,647 E245D possibly damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tns2 T C 15: 102,103,118 L11P possibly damaging Het
Trip11 A G 12: 101,845,056 probably null Het
Ttn T G 2: 76,720,965 Y31361S probably damaging Het
Vars2 T C 17: 35,659,807 E678G possibly damaging Het
Vav1 C A 17: 57,299,122 H249N probably benign Het
Vmn2r9 T A 5: 108,848,165 I206L probably benign Het
Vps4a T C 8: 107,045,054 S410P probably damaging Het
Wdr82 T C 9: 106,176,662 Y71H possibly damaging Het
Zfand1 A G 3: 10,348,571 Y19H probably benign Het
Zfp365 A T 10: 67,909,258 I230N probably damaging Het
Zfp763 T C 17: 33,021,736 T40A probably benign Het
Zfp788 A T 7: 41,647,579 D51V probably damaging Het
Other mutations in Ipcef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Ipcef1 APN 10 6919968 missense probably damaging 1.00
IGL01018:Ipcef1 APN 10 6890551 missense probably benign
IGL01295:Ipcef1 APN 10 6900642 missense probably damaging 1.00
IGL01738:Ipcef1 APN 10 6890575 missense probably damaging 1.00
IGL03095:Ipcef1 APN 10 6919732 missense probably damaging 1.00
R0001:Ipcef1 UTSW 10 6900600 missense probably damaging 0.99
R0206:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R0208:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R1161:Ipcef1 UTSW 10 6980288 critical splice acceptor site probably null
R1496:Ipcef1 UTSW 10 6935173 critical splice donor site probably null
R1592:Ipcef1 UTSW 10 6935182 splice site probably null
R1829:Ipcef1 UTSW 10 6919900 missense probably benign 0.27
R1893:Ipcef1 UTSW 10 6900680 missense probably damaging 1.00
R2107:Ipcef1 UTSW 10 6890501 missense probably benign 0.01
R2160:Ipcef1 UTSW 10 6890650 missense probably damaging 1.00
R2413:Ipcef1 UTSW 10 6935225 missense probably damaging 1.00
R2655:Ipcef1 UTSW 10 6979657 missense probably benign 0.02
R2886:Ipcef1 UTSW 10 6900641 missense probably damaging 1.00
R4752:Ipcef1 UTSW 10 6979573 missense probably damaging 1.00
R5134:Ipcef1 UTSW 10 6919950 missense probably benign 0.03
R5800:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R5938:Ipcef1 UTSW 10 6908029 unclassified probably benign
R5989:Ipcef1 UTSW 10 6979532 nonsense probably null
R7397:Ipcef1 UTSW 10 6972244 makesense probably null
R7414:Ipcef1 UTSW 10 6890673 nonsense probably null
R7425:Ipcef1 UTSW 10 6956066 missense probably damaging 1.00
R7859:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R7966:Ipcef1 UTSW 10 6900668 missense probably damaging 1.00
R8255:Ipcef1 UTSW 10 6920007 missense probably benign 0.10
R9276:Ipcef1 UTSW 10 6907936 unclassified probably benign
R9280:Ipcef1 UTSW 10 6900736 missense probably benign 0.42
R9359:Ipcef1 UTSW 10 6890663 missense probably damaging 1.00
R9407:Ipcef1 UTSW 10 6920036 nonsense probably null
R9526:Ipcef1 UTSW 10 6890620 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTACAAAAGGAGCTGGAGGC -3'
(R):5'- CTGGCACAACATAGTTAACAGCTC -3'

Sequencing Primer
(F):5'- GGCTAACCTCCATGTGACTAATTATC -3'
(R):5'- TCACCTGCTACTGAAGATGCG -3'
Posted On 2021-10-11