Incidental Mutation 'R8964:Tbc1d22b'
ID 682648
Institutional Source Beutler Lab
Gene Symbol Tbc1d22b
Ensembl Gene ENSMUSG00000042203
Gene Name TBC1 domain family, member 22B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8964 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 29549788-29606895 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29600228 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 459 (E459G)
Ref Sequence ENSEMBL: ENSMUSP00000046877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048677]
AlphaFold Q80VE5
Predicted Effect probably damaging
Transcript: ENSMUST00000048677
AA Change: E459G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046877
Gene: ENSMUSG00000042203
AA Change: E459G

DomainStartEndE-ValueType
Blast:TBC 23 93 6e-12 BLAST
TBC 207 460 1.25e-56 SMART
Blast:TBC 464 504 4e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik C T 7: 131,138,987 V167M probably benign Het
Abca6 G A 11: 110,248,537 P37L probably benign Het
Abca9 A T 11: 110,147,249 Y490* probably null Het
Abcb11 A G 2: 69,286,717 V529A possibly damaging Het
Acox2 G T 14: 8,243,768 Y529* probably null Het
Adck2 G T 6: 39,574,149 probably benign Het
Agxt T A 1: 93,145,147 C409S possibly damaging Het
Ahsa1 T A 12: 87,271,357 I164N probably damaging Het
Arhgef1 A G 7: 24,923,037 E647G probably damaging Het
Axin1 T G 17: 26,142,744 F21V probably damaging Het
B3galnt1 A G 3: 69,575,256 I224T probably damaging Het
Bche T C 3: 73,701,073 K340R probably benign Het
Bpifb5 T A 2: 154,230,278 W302R possibly damaging Het
Cd72 G A 4: 43,450,218 T230I probably damaging Het
Cdc42ep4 T A 11: 113,729,452 M38L probably damaging Het
Cdcp1 G A 9: 123,183,496 Q329* probably null Het
Clps C A 17: 28,558,756 probably benign Het
Cluap1 A G 16: 3,911,470 probably benign Het
CN725425 C T 15: 91,235,769 S31L possibly damaging Het
Cnbp T C 6: 87,844,104 N158D probably benign Het
Crebbp A G 16: 4,091,889 F1545S probably damaging Het
Cyp39a1 A T 17: 43,691,667 T258S probably benign Het
Dclk2 T C 3: 86,836,391 D257G probably damaging Het
Dock7 A T 4: 99,061,239 D455E Het
Ehbp1 G A 11: 22,151,154 Q259* probably null Het
Eif3a A T 19: 60,763,192 D1228E unknown Het
Gm498 A G 7: 143,869,293 T39A probably benign Het
Has2 A T 15: 56,667,665 D551E probably damaging Het
Herc1 T A 9: 66,445,590 N2119K probably damaging Het
Hsdl1 C T 8: 119,566,160 A179T probably benign Het
Htt T A 5: 34,905,376 M2818K probably benign Het
Il18bp A G 7: 102,016,384 S80P possibly damaging Het
Ints10 A G 8: 68,811,979 M455V probably benign Het
Ipcef1 T C 10: 6,919,789 T255A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrba T A 3: 86,351,245 D1346E probably benign Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Met C T 6: 17,527,145 P532S probably damaging Het
Nlrc5 T A 8: 94,505,488 M1314K possibly damaging Het
Notch1 A T 2: 26,481,050 S341R possibly damaging Het
Nr3c2 T G 8: 77,155,312 L670V probably damaging Het
Nuak1 C T 10: 84,374,870 M451I probably benign Het
Nubp1 G A 16: 10,421,030 V170I probably benign Het
Olfr1014 T A 2: 85,776,620 I12N probably damaging Het
Olfr110 G A 17: 37,498,773 G41S probably damaging Het
Pamr1 T C 2: 102,634,466 V320A possibly damaging Het
Pcdhb11 T A 18: 37,423,607 N663K probably benign Het
Pcnx G A 12: 81,993,038 G1400D Het
Pdxk A T 10: 78,447,937 V141E probably benign Het
Pex5 A T 6: 124,398,781 N520K probably benign Het
Pklr T C 3: 89,142,729 V337A probably benign Het
Polb T C 8: 22,653,325 D17G probably damaging Het
Ppp1r9b T C 11: 94,991,879 L111P probably damaging Het
Prl3d1 A G 13: 27,099,943 E165G possibly damaging Het
Prpf40a A G 2: 53,145,894 F657S probably damaging Het
Ptgs2 C T 1: 150,105,047 R455C probably damaging Het
Pzp T A 6: 128,487,499 D1355V probably benign Het
Rasl12 T A 9: 65,407,631 V72D probably damaging Het
Rfx2 C A 17: 56,786,696 R266L probably damaging Het
Rnaseh2a T C 8: 84,959,805 D204G probably benign Het
S1pr3 A C 13: 51,419,212 K143T probably damaging Het
Sdr39u1 C A 14: 55,897,713 A258S possibly damaging Het
Sntb2 T A 8: 106,981,176 S191T possibly damaging Het
Sod3 T A 5: 52,368,354 F132I probably damaging Het
Sorcs2 C T 5: 36,229,167 V176I possibly damaging Het
Syne1 T C 10: 5,110,872 I7256V Het
Tbkbp1 A G 11: 97,146,343 S278P probably damaging Het
Thoc5 A T 11: 4,910,647 E245D possibly damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tns2 T C 15: 102,103,118 L11P possibly damaging Het
Trip11 A G 12: 101,845,056 probably null Het
Ttn T G 2: 76,720,965 Y31361S probably damaging Het
Vars2 T C 17: 35,659,807 E678G possibly damaging Het
Vav1 C A 17: 57,299,122 H249N probably benign Het
Vmn2r9 T A 5: 108,848,165 I206L probably benign Het
Vps4a T C 8: 107,045,054 S410P probably damaging Het
Wdr82 T C 9: 106,176,662 Y71H possibly damaging Het
Zfand1 A G 3: 10,348,571 Y19H probably benign Het
Zfp365 A T 10: 67,909,258 I230N probably damaging Het
Zfp763 T C 17: 33,021,736 T40A probably benign Het
Zfp788 A T 7: 41,647,579 D51V probably damaging Het
Other mutations in Tbc1d22b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Tbc1d22b APN 17 29568598 missense possibly damaging 0.60
IGL01836:Tbc1d22b APN 17 29599958 missense probably damaging 1.00
R1524:Tbc1d22b UTSW 17 29570611 missense probably damaging 0.99
R1681:Tbc1d22b UTSW 17 29575177 missense possibly damaging 0.46
R1757:Tbc1d22b UTSW 17 29571673 missense probably damaging 1.00
R2268:Tbc1d22b UTSW 17 29599854 missense probably damaging 1.00
R5656:Tbc1d22b UTSW 17 29594780 missense probably damaging 1.00
R5832:Tbc1d22b UTSW 17 29570647 missense possibly damaging 0.80
R6892:Tbc1d22b UTSW 17 29595890 missense possibly damaging 0.80
R7095:Tbc1d22b UTSW 17 29599869 missense probably damaging 0.96
R7780:Tbc1d22b UTSW 17 29573066 missense probably benign 0.06
R8121:Tbc1d22b UTSW 17 29572971 missense probably damaging 1.00
R8784:Tbc1d22b UTSW 17 29599944 missense probably damaging 1.00
R9641:Tbc1d22b UTSW 17 29594773 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GAGCCCATGTTCTCTGTCAC -3'
(R):5'- AGTGTGTACTTAACCCCAGAACC -3'

Sequencing Primer
(F):5'- CATGTTCTCTGTCACACAAGAGG -3'
(R):5'- GTCTTCCCTCAGCATGTGG -3'
Posted On 2021-10-11