Incidental Mutation 'R8965:Usp20'
ID 682658
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms 1700055M05Rik, Vdu2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8965 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 30982279-31023586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31011785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 521 (Y521N)
Ref Sequence ENSEMBL: ENSMUSP00000099913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102849
AA Change: Y521N

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: Y521N

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170476
AA Change: Y521N

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: Y521N

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,612,604 I1260K probably benign Het
Ace3 G T 11: 106,005,349 C707F probably benign Het
Ahi1 A G 10: 20,963,862 H224R probably benign Het
Atp1a2 T C 1: 172,280,045 D669G probably benign Het
Cdk5rap2 A C 4: 70,266,805 V1136G probably benign Het
Cntnap4 T A 8: 112,753,014 V277E probably damaging Het
Cyp2d12 T C 15: 82,558,985 L416P possibly damaging Het
Dnah17 T G 11: 118,024,666 T4376P probably damaging Het
E4f1 C T 17: 24,445,530 V429M probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Erich6 A T 3: 58,624,317 D419E probably benign Het
Grid2 A G 6: 64,320,006 E451G probably damaging Het
Herpud1 T C 8: 94,391,841 Y181H probably damaging Het
Igkv2-109 A T 6: 68,303,128 Y111F probably damaging Het
Lztr1 T C 16: 17,509,432 probably null Het
Myh13 A T 11: 67,364,606 M1601L probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Olfr1115 A T 2: 87,252,557 I207F possibly damaging Het
Olfr1364 T C 13: 21,574,217 T80A probably benign Het
Olfr472 T C 7: 107,903,107 L130P probably damaging Het
P2rx1 T C 11: 73,009,225 V156A probably benign Het
P3h2 T C 16: 25,972,384 N444S probably benign Het
Patz1 T C 11: 3,307,815 Y559H probably damaging Het
Pcna T C 2: 132,252,849 D63G possibly damaging Het
Pcnx2 G A 8: 125,759,114 A1915V probably benign Het
Peli1 T C 11: 21,148,488 Y408H probably damaging Het
Psma5 T A 3: 108,265,194 probably null Het
Ptpn11 G A 5: 121,163,166 T205M possibly damaging Het
Rapgef2 A G 3: 79,092,544 L453P probably damaging Het
Slc12a4 A G 8: 105,945,350 V910A possibly damaging Het
Spaca6 A G 17: 17,838,456 T306A probably damaging Het
Spata6 T A 4: 111,822,812 Y422* probably null Het
Svop A G 5: 114,035,210 Y367H probably benign Het
Tcrg-V3 T A 13: 19,243,010 L21Q probably damaging Het
Trim38 T C 13: 23,791,023 L315S possibly damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Vcam1 T A 3: 116,128,773 K34* probably null Het
Vwa1 A T 4: 155,772,983 Y119* probably null Het
Vwa5b2 A G 16: 20,596,326 H366R possibly damaging Het
Wac C A 18: 7,905,936 Q168K probably benign Het
Wipf2 A G 11: 98,892,671 S308G probably benign Het
Zbtb25 A C 12: 76,349,803 I215S probably benign Het
Zfp677 T C 17: 21,396,893 S71P probably damaging Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
BB007:Usp20 UTSW 2 31010544 missense probably benign 0.21
BB017:Usp20 UTSW 2 31010544 missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2244:Usp20 UTSW 2 31010331 missense possibly damaging 0.65
R2883:Usp20 UTSW 2 31018800 missense probably benign
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R5862:Usp20 UTSW 2 31006449 nonsense probably null
R6315:Usp20 UTSW 2 31017758 missense possibly damaging 0.70
R7603:Usp20 UTSW 2 31011474 missense probably damaging 1.00
R7887:Usp20 UTSW 2 31020894 missense probably benign 0.34
R7930:Usp20 UTSW 2 31010544 missense probably benign 0.21
R8542:Usp20 UTSW 2 31011624 missense possibly damaging 0.94
R9079:Usp20 UTSW 2 31005108 intron probably benign
R9226:Usp20 UTSW 2 31017400 missense probably damaging 0.99
R9417:Usp20 UTSW 2 30983018 critical splice acceptor site probably null
R9459:Usp20 UTSW 2 31011012 missense probably damaging 0.99
Z1176:Usp20 UTSW 2 31019818 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGGCTGATCTTCACCATTTAGG -3'
(R):5'- GTTTTCCACCTTCAAGGAGTGC -3'

Sequencing Primer
(F):5'- GTGTCTACCACAGTGGAGACATTC -3'
(R):5'- TTCAAGGAGTGCCTAGTCCAG -3'
Posted On 2021-10-11