Mutagenetix > Incidental Mutation

Incidental Mutation 'R8965:Cntnap4'

682676

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

Caspr4, E130114F09Rik

MMRRC Submission

068799-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R8965 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

113296675-113609349 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113479646 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 277 (V277E)

Ref Sequence

ENSEMBL: ENSMUSP00000034225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

AlphaFold

Q99P47

Predicted Effect

probably damaging
Transcript: ENSMUST00000034225
AA Change: V277E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: V277E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118171
AA Change: V277E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: V277E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	A	13: 77,760,723 (GRCm39)	I1260K	probably benign	Het
Ace3	G	T	11: 105,896,175 (GRCm39)	C707F	probably benign	Het
Ahi1	A	G	10: 20,839,761 (GRCm39)	H224R	probably benign	Het
Atp1a2	T	C	1: 172,107,612 (GRCm39)	D669G	probably benign	Het
Cdk5rap2	A	C	4: 70,185,042 (GRCm39)	V1136G	probably benign	Het
Cyp2d12	T	C	15: 82,443,186 (GRCm39)	L416P	possibly damaging	Het
Dnah17	T	G	11: 117,915,492 (GRCm39)	T4376P	probably damaging	Het
E4f1	C	T	17: 24,664,504 (GRCm39)	V429M	probably benign	Het
Epha8	G	T	4: 136,665,897 (GRCm39)	L420M	probably damaging	Het
Erich6	A	T	3: 58,531,738 (GRCm39)	D419E	probably benign	Het
Grid2	A	G	6: 64,296,990 (GRCm39)	E451G	probably damaging	Het
Herpud1	T	C	8: 95,118,469 (GRCm39)	Y181H	probably damaging	Het
Igkv2-109	A	T	6: 68,280,112 (GRCm39)	Y111F	probably damaging	Het
Lztr1	T	C	16: 17,327,296 (GRCm39)		probably null	Het
Myh13	A	T	11: 67,255,432 (GRCm39)	M1601L	probably benign	Het
Nicn1	C	T	9: 108,171,708 (GRCm39)	R163C	possibly damaging	Het
Or10ag53	A	T	2: 87,082,901 (GRCm39)	I207F	possibly damaging	Het
Or2w2	T	C	13: 21,758,387 (GRCm39)	T80A	probably benign	Het
Or5p52	T	C	7: 107,502,314 (GRCm39)	L130P	probably damaging	Het
P2rx1	T	C	11: 72,900,051 (GRCm39)	V156A	probably benign	Het
P3h2	T	C	16: 25,791,134 (GRCm39)	N444S	probably benign	Het
Patz1	T	C	11: 3,257,815 (GRCm39)	Y559H	probably damaging	Het
Pcna	T	C	2: 132,094,769 (GRCm39)	D63G	possibly damaging	Het
Pcnx2	G	A	8: 126,485,853 (GRCm39)	A1915V	probably benign	Het
Peli1	T	C	11: 21,098,488 (GRCm39)	Y408H	probably damaging	Het
Psma5	T	A	3: 108,172,510 (GRCm39)		probably null	Het
Ptpn11	G	A	5: 121,301,229 (GRCm39)	T205M	possibly damaging	Het
Rapgef2	A	G	3: 78,999,851 (GRCm39)	L453P	probably damaging	Het
Slc12a4	A	G	8: 106,671,982 (GRCm39)	V910A	possibly damaging	Het
Spaca6	A	G	17: 18,058,718 (GRCm39)	T306A	probably damaging	Het
Spata6	T	A	4: 111,680,009 (GRCm39)	Y422*	probably null	Het
Svop	A	G	5: 114,173,271 (GRCm39)	Y367H	probably benign	Het
Trgv3	T	A	13: 19,427,180 (GRCm39)	L21Q	probably damaging	Het
Trim38	T	C	13: 23,975,006 (GRCm39)	L315S	possibly damaging	Het
Ttc12	A	G	9: 49,349,718 (GRCm39)	V693A	probably benign	Het
Usp20	T	A	2: 30,901,797 (GRCm39)	Y521N	possibly damaging	Het
Vcam1	T	A	3: 115,922,422 (GRCm39)	K34*	probably null	Het
Vwa1	A	T	4: 155,857,440 (GRCm39)	Y119*	probably null	Het
Vwa5b2	A	G	16: 20,415,076 (GRCm39)	H366R	possibly damaging	Het
Wac	C	A	18: 7,905,936 (GRCm39)	Q168K	probably benign	Het
Wipf2	A	G	11: 98,783,497 (GRCm39)	S308G	probably benign	Het
Zbtb25	A	C	12: 76,396,577 (GRCm39)	I215S	probably benign	Het
Zfp677	T	C	17: 21,617,155 (GRCm39)	S71P	probably damaging	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	113,494,251 (GRCm39)	splice site	probably benign
IGL01898:Cntnap4	APN	8	113,582,939 (GRCm39)	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	113,478,866 (GRCm39)	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	113,343,126 (GRCm39)	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	113,512,535 (GRCm39)	splice site	probably benign
IGL02621:Cntnap4	APN	8	113,537,355 (GRCm39)	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	113,500,222 (GRCm39)	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	113,512,416 (GRCm39)	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	113,569,148 (GRCm39)	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	113,583,143 (GRCm39)	nonsense	probably null
R0497:Cntnap4	UTSW	8	113,296,783 (GRCm39)	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	113,608,395 (GRCm39)	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	113,608,462 (GRCm39)	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	113,484,155 (GRCm39)	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	113,542,128 (GRCm39)	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	113,484,203 (GRCm39)	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	113,484,071 (GRCm39)	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	113,478,939 (GRCm39)	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	113,480,554 (GRCm39)	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	113,391,898 (GRCm39)	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	113,584,842 (GRCm39)	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	113,537,240 (GRCm39)	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	113,537,342 (GRCm39)	missense	probably benign
R4611:Cntnap4	UTSW	8	113,500,371 (GRCm39)	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	113,512,468 (GRCm39)	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	113,460,070 (GRCm39)	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	113,568,385 (GRCm39)	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	113,602,061 (GRCm39)	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	113,569,353 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	113,529,843 (GRCm39)	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	113,478,921 (GRCm39)	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	113,484,105 (GRCm39)	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	113,529,858 (GRCm39)	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	113,584,874 (GRCm39)	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	113,537,268 (GRCm39)	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	113,608,432 (GRCm39)	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	113,391,731 (GRCm39)	splice site	probably null
R7348:Cntnap4	UTSW	8	113,391,909 (GRCm39)	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	113,460,194 (GRCm39)	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	113,484,113 (GRCm39)	missense	probably benign
R7895:Cntnap4	UTSW	8	113,478,829 (GRCm39)	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	113,480,577 (GRCm39)	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	113,391,897 (GRCm39)	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	113,296,857 (GRCm39)	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	113,500,324 (GRCm39)	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	possibly damaging	0.52
R8699:Cntnap4	UTSW	8	113,484,228 (GRCm39)	missense	probably damaging	1.00
R8774:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8774-TAIL:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8872:Cntnap4	UTSW	8	113,585,759 (GRCm39)	missense	possibly damaging	0.79
R8895:Cntnap4	UTSW	8	113,479,598 (GRCm39)	missense	probably benign	0.40
R9189:Cntnap4	UTSW	8	113,602,600 (GRCm39)	missense	possibly damaging	0.92
R9260:Cntnap4	UTSW	8	113,500,276 (GRCm39)	missense	probably benign	0.08
R9474:Cntnap4	UTSW	8	113,460,103 (GRCm39)	missense	probably damaging	0.99
R9565:Cntnap4	UTSW	8	113,582,982 (GRCm39)	missense	probably benign	0.43
R9625:Cntnap4	UTSW	8	113,602,181 (GRCm39)	missense	possibly damaging	0.82
R9629:Cntnap4	UTSW	8	113,568,349 (GRCm39)	missense	probably damaging	1.00
R9745:Cntnap4	UTSW	8	113,391,808 (GRCm39)	missense	possibly damaging	0.89
R9765:Cntnap4	UTSW	8	113,568,496 (GRCm39)	missense	probably damaging	0.97
R9765:Cntnap4	UTSW	8	113,484,110 (GRCm39)	missense	probably benign	0.00
R9793:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
R9795:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
X0025:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	113,542,152 (GRCm39)	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	113,584,821 (GRCm39)	missense	possibly damaging	0.70
Z1186:Cntnap4	UTSW	8	113,479,002 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAAGGTTACAAATTACTGTCAGCG -3'
(R):5'- GGAATACCTTGTCAGCCTGG -3'

Sequencing Primer
(F):5'- AGCGATACTGGTCCATCAAATAG -3'
(R):5'- CAGCCTGGGGATTTATTCTCAAG -3'

Posted On

2021-10-11