Mutagenetix > Incidental Mutation

Incidental Mutation 'R8965:P3h2'

682696

Institutional Source

Beutler Lab

Gene Symbol

P3h2

Ensembl Gene

ENSMUSG00000038168

Gene Name

prolyl 3-hydroxylase 2

Synonyms

Leprel1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8965 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25959288-26105784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25972384 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 444 (N444S)

Ref Sequence

ENSEMBL: ENSMUSP00000038056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039990]

AlphaFold

Q8CG71

Predicted Effect

probably benign
Transcript: ENSMUST00000039990
AA Change: N444S

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: N444S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	27	36	N/A	INTRINSIC
Pfam:TPR_2	42	73	2.5e-5	PFAM
low complexity region	81	104	N/A	INTRINSIC
low complexity region	114	123	N/A	INTRINSIC
Pfam:TPR_2	206	237	1.2e-5	PFAM
low complexity region	253	266	N/A	INTRINSIC
internal_repeat_1	304	366	4.75e-7	PROSPERO
P4Hc	457	665	1.45e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	A	13: 77,612,604	I1260K	probably benign	Het
Ace3	G	T	11: 106,005,349	C707F	probably benign	Het
Ahi1	A	G	10: 20,963,862	H224R	probably benign	Het
Atp1a2	T	C	1: 172,280,045	D669G	probably benign	Het
Cdk5rap2	A	C	4: 70,266,805	V1136G	probably benign	Het
Cntnap4	T	A	8: 112,753,014	V277E	probably damaging	Het
Cyp2d12	T	C	15: 82,558,985	L416P	possibly damaging	Het
Dnah17	T	G	11: 118,024,666	T4376P	probably damaging	Het
E4f1	C	T	17: 24,445,530	V429M	probably benign	Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Erich6	A	T	3: 58,624,317	D419E	probably benign	Het
Grid2	A	G	6: 64,320,006	E451G	probably damaging	Het
Herpud1	T	C	8: 94,391,841	Y181H	probably damaging	Het
Igkv2-109	A	T	6: 68,303,128	Y111F	probably damaging	Het
Lztr1	T	C	16: 17,509,432		probably null	Het
Myh13	A	T	11: 67,364,606	M1601L	probably benign	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Olfr1115	A	T	2: 87,252,557	I207F	possibly damaging	Het
Olfr1364	T	C	13: 21,574,217	T80A	probably benign	Het
Olfr472	T	C	7: 107,903,107	L130P	probably damaging	Het
P2rx1	T	C	11: 73,009,225	V156A	probably benign	Het
Patz1	T	C	11: 3,307,815	Y559H	probably damaging	Het
Pcna	T	C	2: 132,252,849	D63G	possibly damaging	Het
Pcnx2	G	A	8: 125,759,114	A1915V	probably benign	Het
Peli1	T	C	11: 21,148,488	Y408H	probably damaging	Het
Psma5	T	A	3: 108,265,194		probably null	Het
Ptpn11	G	A	5: 121,163,166	T205M	possibly damaging	Het
Rapgef2	A	G	3: 79,092,544	L453P	probably damaging	Het
Slc12a4	A	G	8: 105,945,350	V910A	possibly damaging	Het
Spaca6	A	G	17: 17,838,456	T306A	probably damaging	Het
Spata6	T	A	4: 111,822,812	Y422*	probably null	Het
Svop	A	G	5: 114,035,210	Y367H	probably benign	Het
Tcrg-V3	T	A	13: 19,243,010	L21Q	probably damaging	Het
Trim38	T	C	13: 23,791,023	L315S	possibly damaging	Het
Ttc12	A	G	9: 49,438,418	V693A	probably benign	Het
Usp20	T	A	2: 31,011,785	Y521N	possibly damaging	Het
Vcam1	T	A	3: 116,128,773	K34*	probably null	Het
Vwa1	A	T	4: 155,772,983	Y119*	probably null	Het
Vwa5b2	A	G	16: 20,596,326	H366R	possibly damaging	Het
Wac	C	A	18: 7,905,936	Q168K	probably benign	Het
Wipf2	A	G	11: 98,892,671	S308G	probably benign	Het
Zbtb25	A	C	12: 76,349,803	I215S	probably benign	Het
Zfp677	T	C	17: 21,396,893	S71P	probably damaging	Het

Other mutations in P3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:P3h2	APN	16	25992798	missense	probably damaging	1.00
IGL01012:P3h2	APN	16	25987248	missense	probably damaging	0.98
IGL02393:P3h2	APN	16	25992825	missense	probably damaging	1.00
IGL02436:P3h2	APN	16	25997200	missense	probably benign	0.01
PIT4445001:P3h2	UTSW	16	25984999	missense	probably benign	0.01
R0319:P3h2	UTSW	16	25970931	missense	possibly damaging	0.93
R0403:P3h2	UTSW	16	25969950	missense	possibly damaging	0.63
R0962:P3h2	UTSW	16	25997248	missense	probably benign
R1290:P3h2	UTSW	16	25987203	missense	probably damaging	0.99
R1300:P3h2	UTSW	16	25997236	nonsense	probably null
R1467:P3h2	UTSW	16	25965868	splice site	probably benign
R1643:P3h2	UTSW	16	25972291	missense	probably benign	0.00
R1645:P3h2	UTSW	16	25997232	missense	probably damaging	1.00
R1761:P3h2	UTSW	16	25985050	missense	probably damaging	0.96
R4227:P3h2	UTSW	16	26105453	missense	probably benign
R4273:P3h2	UTSW	16	26105221	missense	probably benign	0.00
R4409:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4410:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4653:P3h2	UTSW	16	26105277	missense	probably damaging	0.98
R4968:P3h2	UTSW	16	25992662	critical splice donor site	probably null
R5190:P3h2	UTSW	16	25984949	missense	possibly damaging	0.86
R6113:P3h2	UTSW	16	25981153	missense	probably benign	0.01
R6225:P3h2	UTSW	16	25965743	missense	probably damaging	0.97
R6838:P3h2	UTSW	16	26105284	missense	possibly damaging	0.73
R6881:P3h2	UTSW	16	25992745	missense	probably damaging	1.00
R7089:P3h2	UTSW	16	25965809	missense	probably damaging	1.00
R7445:P3h2	UTSW	16	25985065	missense	probably damaging	0.96
R7753:P3h2	UTSW	16	25970937	missense	probably damaging	1.00
R8166:P3h2	UTSW	16	25992822	missense	possibly damaging	0.89
R8363:P3h2	UTSW	16	25992718	missense	probably damaging	0.98
R8442:P3h2	UTSW	16	25987205	missense	probably benign	0.05
R8812:P3h2	UTSW	16	25982717	missense	possibly damaging	0.67
R9187:P3h2	UTSW	16	26105436	missense	probably benign	0.27
R9193:P3h2	UTSW	16	26105241	missense	probably benign	0.07
R9533:P3h2	UTSW	16	25970975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGCAAAGGGTCTTTTCC -3'
(R):5'- CCCTCAATCTATATTGTGTTTGTTGA -3'

Sequencing Primer
(F):5'- CCTTCTAGGGTCAGGGTAGGC -3'
(R):5'- AAGAGGTACCTAGCCTAGTCCTTG -3'

Posted On

2021-10-11