Incidental Mutation 'R8966:Serpinb13'
ID 682704
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HURPIN, headpin, HUR7, PI13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R8966 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 106980984-107001195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107000435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 262 (S262P)
Ref Sequence ENSEMBL: ENSMUSP00000027564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably damaging
Transcript: ENSMUST00000027564
AA Change: S262P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: S262P

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136766
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A T 1: 16,080,838 M40K possibly damaging Het
Aak1 A C 6: 86,987,252 N945T unknown Het
Abca13 C G 11: 9,628,588 D4863E probably damaging Het
Abca8a C T 11: 110,071,419 probably null Het
Alppl2 T A 1: 87,087,488 N413I probably damaging Het
Asb13 T A 13: 3,642,093 H24Q probably damaging Het
Atg9b A G 5: 24,391,202 probably null Het
Atp2b4 T A 1: 133,738,579 H245L probably benign Het
B3galt2 A C 1: 143,646,145 R6S probably damaging Het
B4galnt2 T C 11: 95,890,985 H118R probably damaging Het
Clca3b A G 3: 144,839,111 S372P probably benign Het
Cnn1 T C 9: 22,099,420 probably null Het
Cpne6 C T 14: 55,512,603 R64C probably damaging Het
Csmd1 T A 8: 16,200,045 H973L probably damaging Het
Dennd5b A T 6: 148,999,976 H1137Q probably damaging Het
Dnah3 G T 7: 119,950,658 Y500* probably null Het
Dnajc19 A G 3: 34,078,744 V104A unknown Het
Eea1 G A 10: 95,997,039 E249K probably damaging Het
Fancc T C 13: 63,347,471 Q213R probably benign Het
Gabrr1 A G 4: 33,152,411 probably null Het
Gm21319 G T 12: 87,773,503 Y95* probably null Het
Gm6588 T A 5: 112,450,237 W217R probably damaging Het
Gm7534 T C 4: 134,202,401 T198A probably damaging Het
Hgd T A 16: 37,611,170 V113E probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Lrrcc1 T C 3: 14,537,299 C151R probably damaging Het
Marveld3 T C 8: 109,948,387 S266G possibly damaging Het
Mdn1 C T 4: 32,672,837 Q486* probably null Het
Mstn G T 1: 53,066,482 V328L probably benign Het
Ndc80 C A 17: 71,508,578 G404V probably benign Het
Nelfb T C 2: 25,200,739 R557G probably damaging Het
Nol10 T G 12: 17,369,506 V266G possibly damaging Het
Olfr1104 T A 2: 87,022,535 E3V possibly damaging Het
Olfr1465 A T 19: 13,313,832 F151Y probably damaging Het
Olfr608 A T 7: 103,470,317 I93F probably benign Het
Olfr644 A G 7: 104,068,932 L33P probably damaging Het
Olfr790 A T 10: 129,501,082 Y58F probably damaging Het
Optc C A 1: 133,901,134 A245S probably damaging Het
Pcdhb11 A G 18: 37,422,984 T456A possibly damaging Het
Pkd1 A G 17: 24,575,777 E2146G possibly damaging Het
Pkdrej A T 15: 85,817,811 I1308N probably damaging Het
Plekha3 A T 2: 76,692,662 I225F probably benign Het
Ppp1r3c A T 19: 36,734,336 D11E probably benign Het
Pprc1 A G 19: 46,065,679 D1155G unknown Het
Prcc T C 3: 87,884,925 K140E probably damaging Het
Pth1r A T 9: 110,725,161 V334D possibly damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Ric8a A G 7: 140,858,466 E206G probably benign Het
Rps17 C A 7: 81,344,912 V34L probably benign Het
Serpinb6b T A 13: 32,978,052 L278Q probably damaging Het
Slc1a3 C T 15: 8,650,848 probably null Het
Slc27a5 C A 7: 12,991,163 R452S probably benign Het
Slc45a2 T A 15: 11,001,036 W74R probably damaging Het
Slc4a2 A G 5: 24,430,094 T175A probably benign Het
Sos1 C A 17: 80,398,450 G1231C possibly damaging Het
Spata32 T C 11: 103,209,317 T121A probably damaging Het
Srd5a3 T A 5: 76,153,590 F222Y probably benign Het
Stag3 T C 5: 138,291,404 Y279H probably damaging Het
Stk31 T C 6: 49,446,200 I795T possibly damaging Het
Syne2 T C 12: 76,099,423 I1665T probably damaging Het
Tas2r118 A G 6: 23,970,021 Y14H probably damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tnik T G 3: 28,532,895 M105R unknown Het
Trrap A G 5: 144,803,352 T1195A probably damaging Het
Usf1 T A 1: 171,417,533 probably null Het
Usp53 G A 3: 122,961,332 T158I probably damaging Het
Uty T C Y: 1,099,748 E1149G possibly damaging Het
Vmn2r23 G A 6: 123,742,120 V811M possibly damaging Het
Zfp663 T A 2: 165,353,038 K420N probably damaging Het
Zfp703 T C 8: 26,978,274 S91P possibly damaging Het
Zscan4-ps1 A C 7: 11,066,323 I213S probably benign Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106996380 missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 107000754 missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106998958 missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106998910 missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106999021 missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 107000736 missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106982156 start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 107000427 missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106982838 missense probably null 0.15
R3418:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106998572 missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106998697 missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106982185 missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106998602 missense probably benign 0.00
R6015:Serpinb13 UTSW 1 107000607 missense probably benign 0.00
R6363:Serpinb13 UTSW 1 107000774 nonsense probably null
R6720:Serpinb13 UTSW 1 106994062 missense probably benign 0.12
R6847:Serpinb13 UTSW 1 106998933 missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106998949 missense probably damaging 1.00
R8907:Serpinb13 UTSW 1 107000789 missense probably damaging 1.00
R9011:Serpinb13 UTSW 1 106995789 missense probably benign 0.01
R9350:Serpinb13 UTSW 1 106995832 nonsense probably null
R9375:Serpinb13 UTSW 1 106982267 missense probably damaging 1.00
Z1177:Serpinb13 UTSW 1 106982303 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGACTGCATGTGTTCACAC -3'
(R):5'- ACATTCCTGAGTAGTCCGCATG -3'

Sequencing Primer
(F):5'- GCAGAAATGGAAATGCAGATTTTG -3'
(R):5'- TAGTCCGCATGCTCGCTGAAG -3'
Posted On 2021-10-11