Incidental Mutation 'R8966:Vmn2r23'
ID682732
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8966 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123742120 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 811 (V811M)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect possibly damaging
Transcript: ENSMUST00000172391
AA Change: V811M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: V811M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A T 1: 16,080,838 M40K possibly damaging Het
Aak1 A C 6: 86,987,252 N945T unknown Het
Abca13 C G 11: 9,628,588 D4863E probably damaging Het
Abca8a C T 11: 110,071,419 probably null Het
Alppl2 T A 1: 87,087,488 N413I probably damaging Het
Asb13 T A 13: 3,642,093 H24Q probably damaging Het
Atg9b A G 5: 24,391,202 probably null Het
Atp2b4 T A 1: 133,738,579 H245L probably benign Het
B3galt2 A C 1: 143,646,145 R6S probably damaging Het
B4galnt2 T C 11: 95,890,985 H118R probably damaging Het
Clca3b A G 3: 144,839,111 S372P probably benign Het
Cnn1 T C 9: 22,099,420 probably null Het
Cpne6 C T 14: 55,512,603 R64C probably damaging Het
Csmd1 T A 8: 16,200,045 H973L probably damaging Het
Dennd5b A T 6: 148,999,976 H1137Q probably damaging Het
Dnah3 G T 7: 119,950,658 Y500* probably null Het
Dnajc19 A G 3: 34,078,744 V104A unknown Het
Eea1 G A 10: 95,997,039 E249K probably damaging Het
Fancc T C 13: 63,347,471 Q213R probably benign Het
Gabrr1 A G 4: 33,152,411 probably null Het
Gm21319 G T 12: 87,773,503 Y95* probably null Het
Gm6588 T A 5: 112,450,237 W217R probably damaging Het
Gm7534 T C 4: 134,202,401 T198A probably damaging Het
Hgd T A 16: 37,611,170 V113E probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Lrrcc1 T C 3: 14,537,299 C151R probably damaging Het
Marveld3 T C 8: 109,948,387 S266G possibly damaging Het
Mdn1 C T 4: 32,672,837 Q486* probably null Het
Mstn G T 1: 53,066,482 V328L probably benign Het
Ndc80 C A 17: 71,508,578 G404V probably benign Het
Nelfb T C 2: 25,200,739 R557G probably damaging Het
Nol10 T G 12: 17,369,506 V266G possibly damaging Het
Olfr1104 T A 2: 87,022,535 E3V possibly damaging Het
Olfr1465 A T 19: 13,313,832 F151Y probably damaging Het
Olfr608 A T 7: 103,470,317 I93F probably benign Het
Olfr644 A G 7: 104,068,932 L33P probably damaging Het
Olfr790 A T 10: 129,501,082 Y58F probably damaging Het
Optc C A 1: 133,901,134 A245S probably damaging Het
Pcdhb11 A G 18: 37,422,984 T456A possibly damaging Het
Pkd1 A G 17: 24,575,777 E2146G possibly damaging Het
Pkdrej A T 15: 85,817,811 I1308N probably damaging Het
Plekha3 A T 2: 76,692,662 I225F probably benign Het
Ppp1r3c A T 19: 36,734,336 D11E probably benign Het
Pprc1 A G 19: 46,065,679 D1155G unknown Het
Prcc T C 3: 87,884,925 K140E probably damaging Het
Pth1r A T 9: 110,725,161 V334D possibly damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Ric8a A G 7: 140,858,466 E206G probably benign Het
Rps17 C A 7: 81,344,912 V34L probably benign Het
Serpinb13 T C 1: 107,000,435 S262P probably damaging Het
Serpinb6b T A 13: 32,978,052 L278Q probably damaging Het
Slc1a3 C T 15: 8,650,848 probably null Het
Slc27a5 C A 7: 12,991,163 R452S probably benign Het
Slc45a2 T A 15: 11,001,036 W74R probably damaging Het
Slc4a2 A G 5: 24,430,094 T175A probably benign Het
Sos1 C A 17: 80,398,450 G1231C possibly damaging Het
Spata32 T C 11: 103,209,317 T121A probably damaging Het
Srd5a3 T A 5: 76,153,590 F222Y probably benign Het
Stag3 T C 5: 138,291,404 Y279H probably damaging Het
Stk31 T C 6: 49,446,200 I795T possibly damaging Het
Syne2 T C 12: 76,099,423 I1665T probably damaging Het
Tas2r118 A G 6: 23,970,021 Y14H probably damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tnik T G 3: 28,532,895 M105R unknown Het
Trrap A G 5: 144,803,352 T1195A probably damaging Het
Usf1 T A 1: 171,417,533 probably null Het
Usp53 G A 3: 122,961,332 T158I probably damaging Het
Uty T C Y: 1,099,748 E1149G possibly damaging Het
Zfp663 T A 2: 165,353,038 K420N probably damaging Het
Zfp703 T C 8: 26,978,274 S91P possibly damaging Het
Zscan4-ps1 A C 7: 11,066,323 I213S probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTGTTGTAATGAGGGGTCCAC -3'
(R):5'- TGCAGAGTCAGATGCCATTG -3'

Sequencing Primer
(F):5'- CATTCTATTGTGTTCTGGGCTAC -3'
(R):5'- CAGAGTCAGATGCCATTGTTTAG -3'
Posted On2021-10-11