Incidental Mutation 'R8966:Dennd5b'
ID 682733
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 068800-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R8966 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 148901474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1137 (H1137Q)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000111557
AA Change: H1137Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: H1137Q

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A T 1: 16,151,062 (GRCm39) M40K possibly damaging Het
Aak1 A C 6: 86,964,234 (GRCm39) N945T unknown Het
Abca13 C G 11: 9,578,588 (GRCm39) D4863E probably damaging Het
Abca8a C T 11: 109,962,245 (GRCm39) probably null Het
Alppl2 T A 1: 87,015,210 (GRCm39) N413I probably damaging Het
Asb13 T A 13: 3,692,093 (GRCm39) H24Q probably damaging Het
Atg9b A G 5: 24,596,200 (GRCm39) probably null Het
Atp2b4 T A 1: 133,666,317 (GRCm39) H245L probably benign Het
B3galt2 A C 1: 143,521,883 (GRCm39) R6S probably damaging Het
B4galnt2 T C 11: 95,781,811 (GRCm39) H118R probably damaging Het
Ccdc121rt2 T A 5: 112,598,103 (GRCm39) W217R probably damaging Het
Clca3b A G 3: 144,544,872 (GRCm39) S372P probably benign Het
Cnn1 T C 9: 22,010,716 (GRCm39) probably null Het
Cpne6 C T 14: 55,750,060 (GRCm39) R64C probably damaging Het
Csmd1 T A 8: 16,250,059 (GRCm39) H973L probably damaging Het
Dnah3 G T 7: 119,549,881 (GRCm39) Y500* probably null Het
Dnajc19 A G 3: 34,132,893 (GRCm39) V104A unknown Het
Eea1 G A 10: 95,832,901 (GRCm39) E249K probably damaging Het
Eif1ad19 G T 12: 87,740,273 (GRCm39) Y95* probably null Het
Fancc T C 13: 63,495,285 (GRCm39) Q213R probably benign Het
Gabrr1 A G 4: 33,152,411 (GRCm39) probably null Het
Hgd T A 16: 37,431,532 (GRCm39) V113E probably damaging Het
Ints7 T C 1: 191,351,717 (GRCm39) S809P probably benign Het
Lrrcc1 T C 3: 14,602,359 (GRCm39) C151R probably damaging Het
Marveld3 T C 8: 110,675,019 (GRCm39) S266G possibly damaging Het
Mdn1 C T 4: 32,672,837 (GRCm39) Q486* probably null Het
Mstn G T 1: 53,105,641 (GRCm39) V328L probably benign Het
Ndc80 C A 17: 71,815,573 (GRCm39) G404V probably benign Het
Nelfb T C 2: 25,090,751 (GRCm39) R557G probably damaging Het
Nol10 T G 12: 17,419,507 (GRCm39) V266G possibly damaging Het
Optc C A 1: 133,828,872 (GRCm39) A245S probably damaging Het
Or51a43 A G 7: 103,718,139 (GRCm39) L33P probably damaging Het
Or52ae7 A T 7: 103,119,524 (GRCm39) I93F probably benign Het
Or5b111 A T 19: 13,291,196 (GRCm39) F151Y probably damaging Het
Or6c75 A T 10: 129,336,951 (GRCm39) Y58F probably damaging Het
Or8i2 T A 2: 86,852,879 (GRCm39) E3V possibly damaging Het
Pcdhb11 A G 18: 37,556,037 (GRCm39) T456A possibly damaging Het
Pkd1 A G 17: 24,794,751 (GRCm39) E2146G possibly damaging Het
Pkdrej A T 15: 85,702,012 (GRCm39) I1308N probably damaging Het
Plekha3 A T 2: 76,523,006 (GRCm39) I225F probably benign Het
Ppp1r3c A T 19: 36,711,736 (GRCm39) D11E probably benign Het
Pprc1 A G 19: 46,054,118 (GRCm39) D1155G unknown Het
Prcc T C 3: 87,792,232 (GRCm39) K140E probably damaging Het
Pth1r A T 9: 110,554,229 (GRCm39) V334D possibly damaging Het
Rab3d G A 9: 21,826,060 (GRCm39) T118M probably damaging Het
Ric8a A G 7: 140,438,379 (GRCm39) E206G probably benign Het
Rps17 C A 7: 80,994,660 (GRCm39) V34L probably benign Het
Serpinb13 T C 1: 106,928,165 (GRCm39) S262P probably damaging Het
Serpinb6b T A 13: 33,162,035 (GRCm39) L278Q probably damaging Het
Slc1a3 C T 15: 8,680,332 (GRCm39) probably null Het
Slc27a5 C A 7: 12,725,090 (GRCm39) R452S probably benign Het
Slc45a2 T A 15: 11,001,122 (GRCm39) W74R probably damaging Het
Slc4a2 A G 5: 24,635,092 (GRCm39) T175A probably benign Het
Sos1 C A 17: 80,705,879 (GRCm39) G1231C possibly damaging Het
Spata32 T C 11: 103,100,143 (GRCm39) T121A probably damaging Het
Srd5a3 T A 5: 76,301,437 (GRCm39) F222Y probably benign Het
Stag3 T C 5: 138,289,666 (GRCm39) Y279H probably damaging Het
Stk31 T C 6: 49,423,134 (GRCm39) I795T possibly damaging Het
Syne2 T C 12: 76,146,197 (GRCm39) I1665T probably damaging Het
Tas2r118 A G 6: 23,970,020 (GRCm39) Y14H probably damaging Het
Tmc7 G A 7: 118,160,228 (GRCm39) P203L probably benign Het
Tnik T G 3: 28,587,044 (GRCm39) M105R unknown Het
Trrap A G 5: 144,740,162 (GRCm39) T1195A probably damaging Het
Usf1 T A 1: 171,245,101 (GRCm39) probably null Het
Usp53 G A 3: 122,754,981 (GRCm39) T158I probably damaging Het
Uty T C Y: 1,099,748 (GRCm39) E1149G possibly damaging Het
Vmn2r23 G A 6: 123,719,079 (GRCm39) V811M possibly damaging Het
Zfp663 T A 2: 165,194,958 (GRCm39) K420N probably damaging Het
Zfp703 T C 8: 27,468,302 (GRCm39) S91P possibly damaging Het
Zpld2 T C 4: 133,929,712 (GRCm39) T198A probably damaging Het
Zscan4-ps1 A C 7: 10,800,250 (GRCm39) I213S probably benign Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCCCAAAACATACTAGTT -3'
(R):5'- TCAGCTCTTTAATTCTCTAGTGTGG -3'

Sequencing Primer
(F):5'- GCTGGCTTCAAATTCAGAGATCC -3'
(R):5'- TTAGATCCCCTGGAACTACGTCTAAG -3'
Posted On 2021-10-11