Incidental Mutation 'R8966:Pth1r'
ID 682747
Institutional Source Beutler Lab
Gene Symbol Pth1r
Ensembl Gene ENSMUSG00000032492
Gene Name parathyroid hormone 1 receptor
Synonyms PTH-related peptide receptor, PPR, PTH1R, Pthr1, PTH/PTHrP receptor
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8966 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 110722085-110747145 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110725161 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 334 (V334D)
Ref Sequence ENSEMBL: ENSMUSP00000006005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006005] [ENSMUST00000166716] [ENSMUST00000196057] [ENSMUST00000198865] [ENSMUST00000199862]
AlphaFold P41593
Predicted Effect possibly damaging
Transcript: ENSMUST00000006005
AA Change: V334D

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492
AA Change: V334D

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166716
AA Change: V334D

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492
AA Change: V334D

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196057
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198865
AA Change: V334D

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492
AA Change: V334D

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199862
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family 2. This protein is a receptor for parathyroid hormone (PTH) and for parathyroid hormone-like hormone (PTHLH). The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in this receptor are known to be the cause of Jansen's metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), as well as enchodromatosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die in mid-gestation or shortly after birth depending on genetic background, are small in size, have short limbs, and accelerated differentiation of chondrocytes resulting in accelerated bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A T 1: 16,080,838 M40K possibly damaging Het
Aak1 A C 6: 86,987,252 N945T unknown Het
Abca13 C G 11: 9,628,588 D4863E probably damaging Het
Abca8a C T 11: 110,071,419 probably null Het
Alppl2 T A 1: 87,087,488 N413I probably damaging Het
Asb13 T A 13: 3,642,093 H24Q probably damaging Het
Atg9b A G 5: 24,391,202 probably null Het
Atp2b4 T A 1: 133,738,579 H245L probably benign Het
B3galt2 A C 1: 143,646,145 R6S probably damaging Het
B4galnt2 T C 11: 95,890,985 H118R probably damaging Het
Clca3b A G 3: 144,839,111 S372P probably benign Het
Cnn1 T C 9: 22,099,420 probably null Het
Cpne6 C T 14: 55,512,603 R64C probably damaging Het
Csmd1 T A 8: 16,200,045 H973L probably damaging Het
Dennd5b A T 6: 148,999,976 H1137Q probably damaging Het
Dnah3 G T 7: 119,950,658 Y500* probably null Het
Dnajc19 A G 3: 34,078,744 V104A unknown Het
Eea1 G A 10: 95,997,039 E249K probably damaging Het
Fancc T C 13: 63,347,471 Q213R probably benign Het
Gabrr1 A G 4: 33,152,411 probably null Het
Gm21319 G T 12: 87,773,503 Y95* probably null Het
Gm6588 T A 5: 112,450,237 W217R probably damaging Het
Gm7534 T C 4: 134,202,401 T198A probably damaging Het
Hgd T A 16: 37,611,170 V113E probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Lrrcc1 T C 3: 14,537,299 C151R probably damaging Het
Marveld3 T C 8: 109,948,387 S266G possibly damaging Het
Mdn1 C T 4: 32,672,837 Q486* probably null Het
Mstn G T 1: 53,066,482 V328L probably benign Het
Ndc80 C A 17: 71,508,578 G404V probably benign Het
Nelfb T C 2: 25,200,739 R557G probably damaging Het
Nol10 T G 12: 17,369,506 V266G possibly damaging Het
Olfr1104 T A 2: 87,022,535 E3V possibly damaging Het
Olfr1465 A T 19: 13,313,832 F151Y probably damaging Het
Olfr608 A T 7: 103,470,317 I93F probably benign Het
Olfr644 A G 7: 104,068,932 L33P probably damaging Het
Olfr790 A T 10: 129,501,082 Y58F probably damaging Het
Optc C A 1: 133,901,134 A245S probably damaging Het
Pcdhb11 A G 18: 37,422,984 T456A possibly damaging Het
Pkd1 A G 17: 24,575,777 E2146G possibly damaging Het
Pkdrej A T 15: 85,817,811 I1308N probably damaging Het
Plekha3 A T 2: 76,692,662 I225F probably benign Het
Ppp1r3c A T 19: 36,734,336 D11E probably benign Het
Pprc1 A G 19: 46,065,679 D1155G unknown Het
Prcc T C 3: 87,884,925 K140E probably damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Ric8a A G 7: 140,858,466 E206G probably benign Het
Rps17 C A 7: 81,344,912 V34L probably benign Het
Serpinb13 T C 1: 107,000,435 S262P probably damaging Het
Serpinb6b T A 13: 32,978,052 L278Q probably damaging Het
Slc1a3 C T 15: 8,650,848 probably null Het
Slc27a5 C A 7: 12,991,163 R452S probably benign Het
Slc45a2 T A 15: 11,001,036 W74R probably damaging Het
Slc4a2 A G 5: 24,430,094 T175A probably benign Het
Sos1 C A 17: 80,398,450 G1231C possibly damaging Het
Spata32 T C 11: 103,209,317 T121A probably damaging Het
Srd5a3 T A 5: 76,153,590 F222Y probably benign Het
Stag3 T C 5: 138,291,404 Y279H probably damaging Het
Stk31 T C 6: 49,446,200 I795T possibly damaging Het
Syne2 T C 12: 76,099,423 I1665T probably damaging Het
Tas2r118 A G 6: 23,970,021 Y14H probably damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tnik T G 3: 28,532,895 M105R unknown Het
Trrap A G 5: 144,803,352 T1195A probably damaging Het
Usf1 T A 1: 171,417,533 probably null Het
Usp53 G A 3: 122,961,332 T158I probably damaging Het
Uty T C Y: 1,099,748 E1149G possibly damaging Het
Vmn2r23 G A 6: 123,742,120 V811M possibly damaging Het
Zfp663 T A 2: 165,353,038 K420N probably damaging Het
Zfp703 T C 8: 26,978,274 S91P possibly damaging Het
Zscan4-ps1 A C 7: 11,066,323 I213S probably benign Het
Other mutations in Pth1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pth1r APN 9 110727130 missense probably damaging 0.99
IGL01682:Pth1r APN 9 110723706 splice site probably null
IGL02004:Pth1r APN 9 110742308 intron probably benign
IGL02169:Pth1r APN 9 110724435 missense probably damaging 1.00
IGL02548:Pth1r APN 9 110727680 missense probably damaging 1.00
IGL03201:Pth1r APN 9 110722580 missense probably damaging 1.00
R0070:Pth1r UTSW 9 110727550 splice site probably null
R0881:Pth1r UTSW 9 110731573 missense probably damaging 1.00
R1022:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1022:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R1024:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1024:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R2071:Pth1r UTSW 9 110727013 missense probably benign 0.34
R2197:Pth1r UTSW 9 110726990 unclassified probably benign
R2206:Pth1r UTSW 9 110723587 missense probably damaging 1.00
R4184:Pth1r UTSW 9 110742232 start codon destroyed probably null
R4590:Pth1r UTSW 9 110722271 missense probably benign 0.04
R4638:Pth1r UTSW 9 110727073 missense possibly damaging 0.60
R4693:Pth1r UTSW 9 110731624 missense probably damaging 1.00
R5457:Pth1r UTSW 9 110726454 missense possibly damaging 0.88
R6235:Pth1r UTSW 9 110722316 missense possibly damaging 0.64
R6682:Pth1r UTSW 9 110727251 splice site probably null
R6683:Pth1r UTSW 9 110727251 splice site probably null
R6914:Pth1r UTSW 9 110728016 splice site probably null
R6942:Pth1r UTSW 9 110728016 splice site probably null
R7164:Pth1r UTSW 9 110723747 missense possibly damaging 0.66
R7638:Pth1r UTSW 9 110722393 missense probably benign
R7883:Pth1r UTSW 9 110731558 missense probably benign 0.02
R9168:Pth1r UTSW 9 110727136 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AAATTCCTGAGGCTGGAGC -3'
(R):5'- TGCATATGCCCAGCAGGTATG -3'

Sequencing Primer
(F):5'- TGGAGCTGCTGGTGCAC -3'
(R):5'- CACAGGTGCTCACAGGAAGC -3'
Posted On 2021-10-11