Incidental Mutation 'R8966:Abca13'
ID 682750
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene Name ATP-binding cassette, sub-family A member 13
Synonyms A930002G16Rik
MMRRC Submission 068800-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8966 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 9141942-9634259 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 9578588 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 4863 (D4863E)
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042740
AA Change: D4863E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: D4863E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A T 1: 16,151,062 (GRCm39) M40K possibly damaging Het
Aak1 A C 6: 86,964,234 (GRCm39) N945T unknown Het
Abca8a C T 11: 109,962,245 (GRCm39) probably null Het
Alppl2 T A 1: 87,015,210 (GRCm39) N413I probably damaging Het
Asb13 T A 13: 3,692,093 (GRCm39) H24Q probably damaging Het
Atg9b A G 5: 24,596,200 (GRCm39) probably null Het
Atp2b4 T A 1: 133,666,317 (GRCm39) H245L probably benign Het
B3galt2 A C 1: 143,521,883 (GRCm39) R6S probably damaging Het
B4galnt2 T C 11: 95,781,811 (GRCm39) H118R probably damaging Het
Ccdc121rt2 T A 5: 112,598,103 (GRCm39) W217R probably damaging Het
Clca3b A G 3: 144,544,872 (GRCm39) S372P probably benign Het
Cnn1 T C 9: 22,010,716 (GRCm39) probably null Het
Cpne6 C T 14: 55,750,060 (GRCm39) R64C probably damaging Het
Csmd1 T A 8: 16,250,059 (GRCm39) H973L probably damaging Het
Dennd5b A T 6: 148,901,474 (GRCm39) H1137Q probably damaging Het
Dnah3 G T 7: 119,549,881 (GRCm39) Y500* probably null Het
Dnajc19 A G 3: 34,132,893 (GRCm39) V104A unknown Het
Eea1 G A 10: 95,832,901 (GRCm39) E249K probably damaging Het
Eif1ad19 G T 12: 87,740,273 (GRCm39) Y95* probably null Het
Fancc T C 13: 63,495,285 (GRCm39) Q213R probably benign Het
Gabrr1 A G 4: 33,152,411 (GRCm39) probably null Het
Hgd T A 16: 37,431,532 (GRCm39) V113E probably damaging Het
Ints7 T C 1: 191,351,717 (GRCm39) S809P probably benign Het
Lrrcc1 T C 3: 14,602,359 (GRCm39) C151R probably damaging Het
Marveld3 T C 8: 110,675,019 (GRCm39) S266G possibly damaging Het
Mdn1 C T 4: 32,672,837 (GRCm39) Q486* probably null Het
Mstn G T 1: 53,105,641 (GRCm39) V328L probably benign Het
Ndc80 C A 17: 71,815,573 (GRCm39) G404V probably benign Het
Nelfb T C 2: 25,090,751 (GRCm39) R557G probably damaging Het
Nol10 T G 12: 17,419,507 (GRCm39) V266G possibly damaging Het
Optc C A 1: 133,828,872 (GRCm39) A245S probably damaging Het
Or51a43 A G 7: 103,718,139 (GRCm39) L33P probably damaging Het
Or52ae7 A T 7: 103,119,524 (GRCm39) I93F probably benign Het
Or5b111 A T 19: 13,291,196 (GRCm39) F151Y probably damaging Het
Or6c75 A T 10: 129,336,951 (GRCm39) Y58F probably damaging Het
Or8i2 T A 2: 86,852,879 (GRCm39) E3V possibly damaging Het
Pcdhb11 A G 18: 37,556,037 (GRCm39) T456A possibly damaging Het
Pkd1 A G 17: 24,794,751 (GRCm39) E2146G possibly damaging Het
Pkdrej A T 15: 85,702,012 (GRCm39) I1308N probably damaging Het
Plekha3 A T 2: 76,523,006 (GRCm39) I225F probably benign Het
Ppp1r3c A T 19: 36,711,736 (GRCm39) D11E probably benign Het
Pprc1 A G 19: 46,054,118 (GRCm39) D1155G unknown Het
Prcc T C 3: 87,792,232 (GRCm39) K140E probably damaging Het
Pth1r A T 9: 110,554,229 (GRCm39) V334D possibly damaging Het
Rab3d G A 9: 21,826,060 (GRCm39) T118M probably damaging Het
Ric8a A G 7: 140,438,379 (GRCm39) E206G probably benign Het
Rps17 C A 7: 80,994,660 (GRCm39) V34L probably benign Het
Serpinb13 T C 1: 106,928,165 (GRCm39) S262P probably damaging Het
Serpinb6b T A 13: 33,162,035 (GRCm39) L278Q probably damaging Het
Slc1a3 C T 15: 8,680,332 (GRCm39) probably null Het
Slc27a5 C A 7: 12,725,090 (GRCm39) R452S probably benign Het
Slc45a2 T A 15: 11,001,122 (GRCm39) W74R probably damaging Het
Slc4a2 A G 5: 24,635,092 (GRCm39) T175A probably benign Het
Sos1 C A 17: 80,705,879 (GRCm39) G1231C possibly damaging Het
Spata32 T C 11: 103,100,143 (GRCm39) T121A probably damaging Het
Srd5a3 T A 5: 76,301,437 (GRCm39) F222Y probably benign Het
Stag3 T C 5: 138,289,666 (GRCm39) Y279H probably damaging Het
Stk31 T C 6: 49,423,134 (GRCm39) I795T possibly damaging Het
Syne2 T C 12: 76,146,197 (GRCm39) I1665T probably damaging Het
Tas2r118 A G 6: 23,970,020 (GRCm39) Y14H probably damaging Het
Tmc7 G A 7: 118,160,228 (GRCm39) P203L probably benign Het
Tnik T G 3: 28,587,044 (GRCm39) M105R unknown Het
Trrap A G 5: 144,740,162 (GRCm39) T1195A probably damaging Het
Usf1 T A 1: 171,245,101 (GRCm39) probably null Het
Usp53 G A 3: 122,754,981 (GRCm39) T158I probably damaging Het
Uty T C Y: 1,099,748 (GRCm39) E1149G possibly damaging Het
Vmn2r23 G A 6: 123,719,079 (GRCm39) V811M possibly damaging Het
Zfp663 T A 2: 165,194,958 (GRCm39) K420N probably damaging Het
Zfp703 T C 8: 27,468,302 (GRCm39) S91P possibly damaging Het
Zpld2 T C 4: 133,929,712 (GRCm39) T198A probably damaging Het
Zscan4-ps1 A C 7: 10,800,250 (GRCm39) I213S probably benign Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9,247,443 (GRCm39) missense probably benign 0.24
IGL00481:Abca13 APN 11 9,240,969 (GRCm39) missense probably damaging 0.99
IGL00707:Abca13 APN 11 9,241,586 (GRCm39) missense probably damaging 0.99
IGL00755:Abca13 APN 11 9,492,102 (GRCm39) missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9,240,870 (GRCm39) missense probably damaging 1.00
IGL00802:Abca13 APN 11 9,247,717 (GRCm39) missense probably damaging 0.96
IGL00807:Abca13 APN 11 9,328,285 (GRCm39) missense probably benign 0.10
IGL00977:Abca13 APN 11 9,349,284 (GRCm39) missense probably damaging 1.00
IGL01064:Abca13 APN 11 9,433,855 (GRCm39) missense probably benign 0.01
IGL01100:Abca13 APN 11 9,224,673 (GRCm39) splice site probably null
IGL01290:Abca13 APN 11 9,206,232 (GRCm39) missense probably damaging 1.00
IGL01299:Abca13 APN 11 9,248,743 (GRCm39) missense probably benign 0.22
IGL01302:Abca13 APN 11 9,349,470 (GRCm39) splice site probably benign
IGL01307:Abca13 APN 11 9,247,159 (GRCm39) missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9,242,076 (GRCm39) missense probably benign 0.05
IGL01351:Abca13 APN 11 9,217,565 (GRCm39) missense probably benign 0.28
IGL01446:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01453:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01461:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01476:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01506:Abca13 APN 11 9,247,447 (GRCm39) missense probably benign 0.36
IGL01527:Abca13 APN 11 9,240,788 (GRCm39) missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9,259,020 (GRCm39) missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9,243,527 (GRCm39) missense probably benign 0.00
IGL01679:Abca13 APN 11 9,248,071 (GRCm39) missense probably benign 0.07
IGL01731:Abca13 APN 11 9,199,749 (GRCm39) splice site probably benign
IGL01762:Abca13 APN 11 9,265,423 (GRCm39) missense probably benign 0.18
IGL01781:Abca13 APN 11 9,349,280 (GRCm39) missense probably damaging 1.00
IGL01802:Abca13 APN 11 9,242,438 (GRCm39) missense probably benign 0.00
IGL01809:Abca13 APN 11 9,240,339 (GRCm39) missense probably damaging 0.96
IGL01906:Abca13 APN 11 9,166,225 (GRCm39) missense probably damaging 1.00
IGL01928:Abca13 APN 11 9,633,342 (GRCm39) missense probably benign 0.13
IGL01940:Abca13 APN 11 9,517,661 (GRCm39) splice site probably benign
IGL01993:Abca13 APN 11 9,208,452 (GRCm39) unclassified probably benign
IGL02039:Abca13 APN 11 9,247,193 (GRCm39) nonsense probably null
IGL02159:Abca13 APN 11 9,264,545 (GRCm39) missense probably benign 0.00
IGL02202:Abca13 APN 11 9,238,529 (GRCm39) missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9,240,626 (GRCm39) missense probably benign 0.00
IGL02332:Abca13 APN 11 9,241,482 (GRCm39) missense probably damaging 0.98
IGL02380:Abca13 APN 11 9,241,599 (GRCm39) missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9,247,527 (GRCm39) missense probably benign 0.00
IGL02505:Abca13 APN 11 9,531,498 (GRCm39) missense probably damaging 1.00
IGL02507:Abca13 APN 11 9,349,388 (GRCm39) missense probably damaging 1.00
IGL02558:Abca13 APN 11 9,349,387 (GRCm39) missense probably damaging 1.00
IGL02581:Abca13 APN 11 9,349,132 (GRCm39) splice site probably benign
IGL02586:Abca13 APN 11 9,243,983 (GRCm39) missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9,381,898 (GRCm39) missense probably damaging 1.00
IGL02747:Abca13 APN 11 9,323,282 (GRCm39) nonsense probably null
IGL02893:Abca13 APN 11 9,240,543 (GRCm39) missense probably damaging 0.96
IGL02930:Abca13 APN 11 9,328,226 (GRCm39) missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9,328,291 (GRCm39) missense probably damaging 0.99
IGL02983:Abca13 APN 11 9,240,663 (GRCm39) missense probably benign 0.40
IGL02999:Abca13 APN 11 9,531,757 (GRCm39) splice site probably benign
IGL03100:Abca13 APN 11 9,208,527 (GRCm39) missense probably benign 0.25
IGL03114:Abca13 APN 11 9,478,999 (GRCm39) missense probably benign 0.06
IGL03230:Abca13 APN 11 9,244,313 (GRCm39) missense probably benign 0.02
IGL03329:Abca13 APN 11 9,248,047 (GRCm39) missense probably benign 0.08
IGL03380:Abca13 APN 11 9,248,574 (GRCm39) missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9,401,515 (GRCm39) missense probably damaging 1.00
PIT4366001:Abca13 UTSW 11 9,244,962 (GRCm39) missense probably benign
PIT4458001:Abca13 UTSW 11 9,248,304 (GRCm39) missense probably benign 0.05
R0017:Abca13 UTSW 11 9,242,775 (GRCm39) missense probably damaging 0.99
R0079:Abca13 UTSW 11 9,243,493 (GRCm39) missense probably benign 0.00
R0089:Abca13 UTSW 11 9,242,886 (GRCm39) missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0113:Abca13 UTSW 11 9,242,114 (GRCm39) missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0152:Abca13 UTSW 11 9,531,724 (GRCm39) missense probably damaging 0.98
R0255:Abca13 UTSW 11 9,531,545 (GRCm39) missense probably damaging 1.00
R0277:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0278:Abca13 UTSW 11 9,328,215 (GRCm39) missense probably damaging 1.00
R0294:Abca13 UTSW 11 9,219,122 (GRCm39) splice site probably null
R0299:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0310:Abca13 UTSW 11 9,243,810 (GRCm39) missense probably benign 0.36
R0317:Abca13 UTSW 11 9,243,459 (GRCm39) missense probably damaging 1.00
R0323:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0324:Abca13 UTSW 11 9,247,669 (GRCm39) missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9,349,430 (GRCm39) missense probably damaging 0.97
R0336:Abca13 UTSW 11 9,248,481 (GRCm39) missense probably benign 0.04
R0346:Abca13 UTSW 11 9,516,278 (GRCm39) missense probably damaging 0.99
R0380:Abca13 UTSW 11 9,538,500 (GRCm39) splice site probably null
R0382:Abca13 UTSW 11 9,586,650 (GRCm39) splice site probably benign
R0482:Abca13 UTSW 11 9,278,207 (GRCm39) missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9,281,687 (GRCm39) missense probably benign 0.07
R0491:Abca13 UTSW 11 9,248,235 (GRCm39) missense probably benign 0.02
R0496:Abca13 UTSW 11 9,241,701 (GRCm39) missense probably benign 0.01
R0505:Abca13 UTSW 11 9,241,058 (GRCm39) missense probably benign 0.00
R0511:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign
R0525:Abca13 UTSW 11 9,243,371 (GRCm39) missense probably damaging 1.00
R0538:Abca13 UTSW 11 9,217,622 (GRCm39) critical splice donor site probably null
R0615:Abca13 UTSW 11 9,206,197 (GRCm39) missense probably damaging 0.96
R0634:Abca13 UTSW 11 9,264,491 (GRCm39) missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9,538,508 (GRCm39) splice site probably benign
R0848:Abca13 UTSW 11 9,632,011 (GRCm39) nonsense probably null
R0883:Abca13 UTSW 11 9,241,238 (GRCm39) nonsense probably null
R0892:Abca13 UTSW 11 9,248,305 (GRCm39) missense probably benign 0.00
R0904:Abca13 UTSW 11 9,248,740 (GRCm39) missense probably benign 0.22
R0968:Abca13 UTSW 11 9,248,016 (GRCm39) missense probably benign 0.00
R1187:Abca13 UTSW 11 9,478,981 (GRCm39) missense probably benign 0.00
R1299:Abca13 UTSW 11 9,244,821 (GRCm39) missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9,241,836 (GRCm39) missense probably benign
R1387:Abca13 UTSW 11 9,632,085 (GRCm39) nonsense probably null
R1436:Abca13 UTSW 11 9,242,646 (GRCm39) missense probably damaging 0.99
R1449:Abca13 UTSW 11 9,248,580 (GRCm39) missense probably damaging 1.00
R1450:Abca13 UTSW 11 9,380,531 (GRCm39) splice site probably benign
R1462:Abca13 UTSW 11 9,433,924 (GRCm39) splice site probably benign
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1466:Abca13 UTSW 11 9,520,536 (GRCm39) splice site probably benign
R1494:Abca13 UTSW 11 9,416,429 (GRCm39) nonsense probably null
R1559:Abca13 UTSW 11 9,349,180 (GRCm39) missense probably null 1.00
R1564:Abca13 UTSW 11 9,384,316 (GRCm39) nonsense probably null
R1698:Abca13 UTSW 11 9,264,507 (GRCm39) missense probably benign 0.13
R1728:Abca13 UTSW 11 9,199,680 (GRCm39) missense probably benign 0.02
R1734:Abca13 UTSW 11 9,535,460 (GRCm39) missense probably benign 0.03
R1781:Abca13 UTSW 11 9,219,194 (GRCm39) missense probably damaging 1.00
R1782:Abca13 UTSW 11 9,247,971 (GRCm39) missense probably benign 0.36
R1807:Abca13 UTSW 11 9,241,755 (GRCm39) missense probably damaging 0.98
R1830:Abca13 UTSW 11 9,240,350 (GRCm39) missense probably benign 0.04
R1869:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1870:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1871:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1903:Abca13 UTSW 11 9,416,411 (GRCm39) missense probably benign 0.13
R1916:Abca13 UTSW 11 9,484,456 (GRCm39) missense probably damaging 1.00
R1936:Abca13 UTSW 11 9,243,595 (GRCm39) missense probably benign 0.13
R1976:Abca13 UTSW 11 9,347,815 (GRCm39) missense probably damaging 1.00
R2001:Abca13 UTSW 11 9,223,967 (GRCm39) missense probably benign 0.01
R2007:Abca13 UTSW 11 9,141,987 (GRCm39) missense probably benign 0.19
R2016:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2017:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2034:Abca13 UTSW 11 9,242,628 (GRCm39) missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9,278,098 (GRCm39) missense probably benign 0.04
R2075:Abca13 UTSW 11 9,472,382 (GRCm39) missense probably damaging 1.00
R2118:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2120:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2124:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2148:Abca13 UTSW 11 9,565,764 (GRCm39) missense probably damaging 1.00
R2149:Abca13 UTSW 11 9,217,508 (GRCm39) missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9,527,170 (GRCm39) missense probably damaging 0.97
R2167:Abca13 UTSW 11 9,238,532 (GRCm39) missense probably benign 0.19
R2261:Abca13 UTSW 11 9,242,288 (GRCm39) missense probably benign
R2263:Abca13 UTSW 11 9,224,702 (GRCm39) missense probably benign 0.04
R2281:Abca13 UTSW 11 9,278,136 (GRCm39) missense probably damaging 0.98
R2340:Abca13 UTSW 11 9,349,165 (GRCm39) missense probably damaging 0.99
R2357:Abca13 UTSW 11 9,247,336 (GRCm39) missense probably damaging 1.00
R2370:Abca13 UTSW 11 9,206,185 (GRCm39) missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9,217,450 (GRCm39) splice site probably benign
R2393:Abca13 UTSW 11 9,225,057 (GRCm39) nonsense probably null
R2432:Abca13 UTSW 11 9,401,333 (GRCm39) splice site probably benign
R2446:Abca13 UTSW 11 9,225,101 (GRCm39) missense probably benign
R2568:Abca13 UTSW 11 9,283,310 (GRCm39) missense probably benign 0.40
R2847:Abca13 UTSW 11 9,244,584 (GRCm39) missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2861:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2862:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2877:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9,266,119 (GRCm39) splice site probably benign
R3789:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R3933:Abca13 UTSW 11 9,304,856 (GRCm39) missense probably damaging 1.00
R3981:Abca13 UTSW 11 9,482,407 (GRCm39) missense probably benign
R4002:Abca13 UTSW 11 9,535,415 (GRCm39) missense probably benign 0.00
R4010:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4011:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4127:Abca13 UTSW 11 9,141,973 (GRCm39) missense probably benign 0.00
R4214:Abca13 UTSW 11 9,243,877 (GRCm39) missense probably damaging 0.96
R4236:Abca13 UTSW 11 9,206,205 (GRCm39) missense probably damaging 1.00
R4237:Abca13 UTSW 11 9,384,188 (GRCm39) missense probably benign 0.01
R4359:Abca13 UTSW 11 9,247,629 (GRCm39) missense probably benign 0.02
R4378:Abca13 UTSW 11 9,243,644 (GRCm39) missense probably benign 0.00
R4389:Abca13 UTSW 11 9,247,878 (GRCm39) missense probably damaging 0.98
R4392:Abca13 UTSW 11 9,259,034 (GRCm39) missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9,259,130 (GRCm39) missense probably damaging 1.00
R4684:Abca13 UTSW 11 9,384,193 (GRCm39) nonsense probably null
R4691:Abca13 UTSW 11 9,384,195 (GRCm39) missense probably damaging 1.00
R4700:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9,226,990 (GRCm39) missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9,227,973 (GRCm39) critical splice donor site probably null
R4772:Abca13 UTSW 11 9,265,339 (GRCm39) splice site probably null
R4782:Abca13 UTSW 11 9,278,096 (GRCm39) missense probably damaging 0.96
R4801:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9,492,077 (GRCm39) nonsense probably null
R4851:Abca13 UTSW 11 9,433,890 (GRCm39) missense probably benign 0.02
R4857:Abca13 UTSW 11 9,244,143 (GRCm39) missense probably benign 0.22
R4869:Abca13 UTSW 11 9,265,434 (GRCm39) splice site probably null
R4982:Abca13 UTSW 11 9,242,348 (GRCm39) missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9,247,678 (GRCm39) missense probably damaging 0.99
R5044:Abca13 UTSW 11 9,323,323 (GRCm39) missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9,208,535 (GRCm39) missense probably damaging 1.00
R5155:Abca13 UTSW 11 9,482,447 (GRCm39) missense probably damaging 0.98
R5173:Abca13 UTSW 11 9,632,032 (GRCm39) frame shift probably null
R5180:Abca13 UTSW 11 9,416,510 (GRCm39) missense probably benign 0.01
R5244:Abca13 UTSW 11 9,225,081 (GRCm39) missense probably benign 0.28
R5257:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9,381,861 (GRCm39) missense probably damaging 1.00
R5363:Abca13 UTSW 11 9,227,035 (GRCm39) missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9,578,629 (GRCm39) missense probably damaging 1.00
R5419:Abca13 UTSW 11 9,143,533 (GRCm39) critical splice donor site probably null
R5426:Abca13 UTSW 11 9,240,722 (GRCm39) missense probably damaging 1.00
R5468:Abca13 UTSW 11 9,244,062 (GRCm39) missense probably damaging 1.00
R5477:Abca13 UTSW 11 9,251,298 (GRCm39) missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.00
R5553:Abca13 UTSW 11 9,278,158 (GRCm39) missense probably damaging 1.00
R5556:Abca13 UTSW 11 9,208,546 (GRCm39) missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9,244,615 (GRCm39) nonsense probably null
R5582:Abca13 UTSW 11 9,586,639 (GRCm39) splice site probably null
R5604:Abca13 UTSW 11 9,516,279 (GRCm39) missense probably damaging 0.97
R5609:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R5617:Abca13 UTSW 11 9,227,891 (GRCm39) missense probably benign 0.00
R5693:Abca13 UTSW 11 9,266,233 (GRCm39) missense probably benign 0.29
R5707:Abca13 UTSW 11 9,460,620 (GRCm39) missense probably damaging 1.00
R5725:Abca13 UTSW 11 9,527,181 (GRCm39) missense probably benign 0.00
R5728:Abca13 UTSW 11 9,520,576 (GRCm39) missense probably damaging 1.00
R5738:Abca13 UTSW 11 9,571,917 (GRCm39) missense probably damaging 1.00
R5758:Abca13 UTSW 11 9,264,536 (GRCm39) missense probably damaging 0.97
R5762:Abca13 UTSW 11 9,531,665 (GRCm39) missense probably damaging 1.00
R5771:Abca13 UTSW 11 9,241,411 (GRCm39) missense probably damaging 1.00
R5809:Abca13 UTSW 11 9,243,692 (GRCm39) missense probably damaging 1.00
R5826:Abca13 UTSW 11 9,632,056 (GRCm39) missense probably damaging 0.99
R5831:Abca13 UTSW 11 9,517,777 (GRCm39) nonsense probably null
R5834:Abca13 UTSW 11 9,227,974 (GRCm39) critical splice donor site probably null
R5902:Abca13 UTSW 11 9,247,177 (GRCm39) missense probably damaging 1.00
R5933:Abca13 UTSW 11 9,199,658 (GRCm39) missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9,243,398 (GRCm39) missense probably benign 0.04
R5969:Abca13 UTSW 11 9,242,214 (GRCm39) nonsense probably null
R5985:Abca13 UTSW 11 9,241,628 (GRCm39) missense probably benign 0.02
R5998:Abca13 UTSW 11 9,517,708 (GRCm39) missense probably damaging 0.97
R6021:Abca13 UTSW 11 9,240,465 (GRCm39) nonsense probably null
R6022:Abca13 UTSW 11 9,240,759 (GRCm39) missense probably damaging 1.00
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9,347,812 (GRCm39) missense probably damaging 1.00
R6153:Abca13 UTSW 11 9,251,259 (GRCm39) critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9,259,047 (GRCm39) missense probably damaging 1.00
R6187:Abca13 UTSW 11 9,259,085 (GRCm39) missense probably damaging 1.00
R6247:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R6329:Abca13 UTSW 11 9,227,937 (GRCm39) missense probably damaging 1.00
R6352:Abca13 UTSW 11 9,259,139 (GRCm39) splice site probably null
R6367:Abca13 UTSW 11 9,166,248 (GRCm39) missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9,248,778 (GRCm39) missense probably benign 0.01
R6424:Abca13 UTSW 11 9,460,542 (GRCm39) missense probably benign
R6456:Abca13 UTSW 11 9,240,474 (GRCm39) missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9,248,661 (GRCm39) missense probably benign 0.00
R6547:Abca13 UTSW 11 9,224,757 (GRCm39) missense probably benign 0.04
R6594:Abca13 UTSW 11 9,244,632 (GRCm39) missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9,328,384 (GRCm39) missense probably damaging 1.00
R6614:Abca13 UTSW 11 9,244,371 (GRCm39) missense probably benign 0.04
R6736:Abca13 UTSW 11 9,415,058 (GRCm39) missense probably damaging 1.00
R6742:Abca13 UTSW 11 9,278,168 (GRCm39) missense probably damaging 1.00
R6791:Abca13 UTSW 11 9,328,504 (GRCm39) missense probably damaging 1.00
R6834:Abca13 UTSW 11 9,225,110 (GRCm39) missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9,248,568 (GRCm39) missense probably damaging 0.96
R6955:Abca13 UTSW 11 9,244,307 (GRCm39) missense probably benign 0.28
R7031:Abca13 UTSW 11 9,571,892 (GRCm39) missense probably damaging 1.00
R7065:Abca13 UTSW 11 9,242,595 (GRCm39) missense probably benign 0.02
R7067:Abca13 UTSW 11 9,241,845 (GRCm39) missense probably benign 0.14
R7070:Abca13 UTSW 11 9,240,701 (GRCm39) missense probably benign 0.06
R7094:Abca13 UTSW 11 9,248,610 (GRCm39) missense probably damaging 0.96
R7102:Abca13 UTSW 11 9,285,215 (GRCm39) missense probably damaging 1.00
R7105:Abca13 UTSW 11 9,347,842 (GRCm39) missense probably damaging 1.00
R7131:Abca13 UTSW 11 9,241,893 (GRCm39) missense probably benign 0.37
R7155:Abca13 UTSW 11 9,479,010 (GRCm39) missense probably benign
R7158:Abca13 UTSW 11 9,223,982 (GRCm39) missense probably benign
R7212:Abca13 UTSW 11 9,248,854 (GRCm39) missense probably benign 0.04
R7215:Abca13 UTSW 11 9,238,405 (GRCm39) splice site probably null
R7228:Abca13 UTSW 11 9,247,653 (GRCm39) missense probably benign
R7231:Abca13 UTSW 11 9,244,175 (GRCm39) missense probably benign 0.25
R7247:Abca13 UTSW 11 9,240,732 (GRCm39) missense probably benign 0.00
R7278:Abca13 UTSW 11 9,241,126 (GRCm39) missense possibly damaging 0.56
R7299:Abca13 UTSW 11 9,244,649 (GRCm39) missense probably damaging 0.98
R7304:Abca13 UTSW 11 9,247,203 (GRCm39) missense probably benign
R7328:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.14
R7374:Abca13 UTSW 11 9,242,136 (GRCm39) missense possibly damaging 0.46
R7376:Abca13 UTSW 11 9,241,118 (GRCm39) missense probably benign 0.00
R7384:Abca13 UTSW 11 9,283,257 (GRCm39) missense probably damaging 1.00
R7395:Abca13 UTSW 11 9,241,658 (GRCm39) missense probably benign 0.01
R7419:Abca13 UTSW 11 9,247,833 (GRCm39) missense probably damaging 1.00
R7419:Abca13 UTSW 11 9,226,959 (GRCm39) missense probably damaging 1.00
R7421:Abca13 UTSW 11 9,460,463 (GRCm39) missense probably benign
R7458:Abca13 UTSW 11 9,240,777 (GRCm39) missense possibly damaging 0.94
R7474:Abca13 UTSW 11 9,278,088 (GRCm39) nonsense probably null
R7492:Abca13 UTSW 11 9,243,167 (GRCm39) missense probably benign 0.08
R7660:Abca13 UTSW 11 9,240,678 (GRCm39) missense probably benign 0.00
R7677:Abca13 UTSW 11 9,248,349 (GRCm39) nonsense probably null
R7744:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R7790:Abca13 UTSW 11 9,247,915 (GRCm39) missense probably damaging 1.00
R7798:Abca13 UTSW 11 9,241,664 (GRCm39) missense probably benign 0.04
R7811:Abca13 UTSW 11 9,527,141 (GRCm39) splice site probably null
R7831:Abca13 UTSW 11 9,247,404 (GRCm39) missense possibly damaging 0.46
R7867:Abca13 UTSW 11 9,212,139 (GRCm39) critical splice donor site probably null
R7910:Abca13 UTSW 11 9,531,590 (GRCm39) missense probably damaging 1.00
R7964:Abca13 UTSW 11 9,266,146 (GRCm39) missense probably benign 0.06
R8037:Abca13 UTSW 11 9,243,904 (GRCm39) missense probably damaging 1.00
R8049:Abca13 UTSW 11 9,241,867 (GRCm39) missense probably damaging 0.99
R8059:Abca13 UTSW 11 9,323,279 (GRCm39) missense probably benign 0.00
R8072:Abca13 UTSW 11 9,244,574 (GRCm39) missense probably benign 0.10
R8078:Abca13 UTSW 11 9,251,279 (GRCm39) missense probably benign 0.32
R8112:Abca13 UTSW 11 9,264,624 (GRCm39) missense probably benign 0.01
R8146:Abca13 UTSW 11 9,347,829 (GRCm39) missense probably damaging 1.00
R8164:Abca13 UTSW 11 9,565,799 (GRCm39) missense probably damaging 1.00
R8195:Abca13 UTSW 11 9,224,735 (GRCm39) missense probably benign 0.00
R8220:Abca13 UTSW 11 9,384,299 (GRCm39) missense possibly damaging 0.58
R8235:Abca13 UTSW 11 9,212,077 (GRCm39) missense probably damaging 0.99
R8307:Abca13 UTSW 11 9,227,922 (GRCm39) nonsense probably null
R8310:Abca13 UTSW 11 9,328,269 (GRCm39) missense possibly damaging 0.90
R8315:Abca13 UTSW 11 9,535,502 (GRCm39) missense probably benign 0.44
R8315:Abca13 UTSW 11 9,328,460 (GRCm39) missense probably null 1.00
R8324:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,347,841 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,265,416 (GRCm39) missense probably benign 0.00
R8400:Abca13 UTSW 11 9,248,218 (GRCm39) missense probably damaging 0.97
R8400:Abca13 UTSW 11 9,243,925 (GRCm39) missense probably benign 0.00
R8425:Abca13 UTSW 11 9,264,623 (GRCm39) missense possibly damaging 0.92
R8486:Abca13 UTSW 11 9,225,092 (GRCm39) missense probably benign 0.00
R8493:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R8502:Abca13 UTSW 11 9,219,282 (GRCm39) missense probably benign 0.02
R8716:Abca13 UTSW 11 9,243,774 (GRCm39) missense probably benign 0.09
R8787:Abca13 UTSW 11 9,225,053 (GRCm39) missense possibly damaging 0.92
R8829:Abca13 UTSW 11 9,571,881 (GRCm39) missense probably damaging 1.00
R8859:Abca13 UTSW 11 9,328,397 (GRCm39) missense
R8871:Abca13 UTSW 11 9,248,071 (GRCm39) missense probably benign 0.07
R8883:Abca13 UTSW 11 9,283,168 (GRCm39) missense probably benign 0.00
R8919:Abca13 UTSW 11 9,241,653 (GRCm39) missense possibly damaging 0.84
R8967:Abca13 UTSW 11 9,242,696 (GRCm39) missense probably benign 0.18
R8969:Abca13 UTSW 11 9,227,944 (GRCm39) missense probably benign
R8972:Abca13 UTSW 11 9,278,138 (GRCm39) missense probably damaging 1.00
R9002:Abca13 UTSW 11 9,241,926 (GRCm39) missense possibly damaging 0.94
R9046:Abca13 UTSW 11 9,243,525 (GRCm39) missense probably benign 0.04
R9051:Abca13 UTSW 11 9,285,232 (GRCm39) missense probably damaging 1.00
R9056:Abca13 UTSW 11 9,414,921 (GRCm39) missense probably damaging 1.00
R9061:Abca13 UTSW 11 9,227,847 (GRCm39) missense probably benign 0.02
R9072:Abca13 UTSW 11 9,240,834 (GRCm39) missense possibly damaging 0.93
R9090:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9127:Abca13 UTSW 11 9,242,080 (GRCm39) missense probably benign 0.03
R9164:Abca13 UTSW 11 9,278,157 (GRCm39) missense probably damaging 1.00
R9175:Abca13 UTSW 11 9,531,593 (GRCm39) missense probably damaging 0.98
R9190:Abca13 UTSW 11 9,241,886 (GRCm39) missense probably damaging 0.96
R9244:Abca13 UTSW 11 9,241,577 (GRCm39) missense probably benign 0.01
R9255:Abca13 UTSW 11 9,278,213 (GRCm39) missense probably damaging 1.00
R9271:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9321:Abca13 UTSW 11 9,460,475 (GRCm39) missense probably benign 0.00
R9356:Abca13 UTSW 11 9,206,305 (GRCm39) missense probably benign 0.11
R9369:Abca13 UTSW 11 9,328,444 (GRCm39) missense probably damaging 1.00
R9423:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R9432:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign 0.00
R9455:Abca13 UTSW 11 9,353,897 (GRCm39) missense probably damaging 1.00
R9486:Abca13 UTSW 11 9,240,621 (GRCm39) missense possibly damaging 0.88
R9492:Abca13 UTSW 11 9,243,667 (GRCm39) nonsense probably null
R9511:Abca13 UTSW 11 9,278,130 (GRCm39) missense probably benign 0.16
R9545:Abca13 UTSW 11 9,416,538 (GRCm39) missense probably damaging 1.00
R9566:Abca13 UTSW 11 9,414,927 (GRCm39) missense probably damaging 1.00
R9609:Abca13 UTSW 11 9,208,549 (GRCm39) missense probably damaging 1.00
R9616:Abca13 UTSW 11 9,240,501 (GRCm39) missense probably benign 0.00
R9651:Abca13 UTSW 11 9,535,484 (GRCm39) missense probably benign
R9651:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9653:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9657:Abca13 UTSW 11 9,243,379 (GRCm39) missense probably benign 0.35
R9684:Abca13 UTSW 11 9,283,307 (GRCm39) missense probably damaging 1.00
X0013:Abca13 UTSW 11 9,223,899 (GRCm39) missense probably benign 0.02
X0057:Abca13 UTSW 11 9,244,744 (GRCm39) missense probably damaging 0.96
X0066:Abca13 UTSW 11 9,217,565 (GRCm39) missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9,244,687 (GRCm39) missense probably damaging 0.99
Z1176:Abca13 UTSW 11 9,217,461 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,201,376 (GRCm39) missense possibly damaging 0.88
Z1176:Abca13 UTSW 11 9,285,182 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,285,181 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,244,342 (GRCm39) missense probably benign 0.01
Z1177:Abca13 UTSW 11 9,264,545 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAAGACCTCTTGTGTGGCCC -3'
(R):5'- TGAAGACTACTGAAGGTTCTTCC -3'

Sequencing Primer
(F):5'- CCTCTGCAGGAGTGGAGGATAC -3'
(R):5'- CCTTCCATTCTCTGGGTGAC -3'
Posted On 2021-10-11