Incidental Mutation 'R8966:Serpinb6b'
ID 682758
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock # R8966 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32978052 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 278 (L278Q)
Ref Sequence ENSEMBL: ENSMUSP00000105922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably benign
Transcript: ENSMUST00000017184
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110293
AA Change: L278Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: L278Q

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164541
AA Change: L159Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A T 1: 16,080,838 M40K possibly damaging Het
Aak1 A C 6: 86,987,252 N945T unknown Het
Abca13 C G 11: 9,628,588 D4863E probably damaging Het
Abca8a C T 11: 110,071,419 probably null Het
Alppl2 T A 1: 87,087,488 N413I probably damaging Het
Asb13 T A 13: 3,642,093 H24Q probably damaging Het
Atg9b A G 5: 24,391,202 probably null Het
Atp2b4 T A 1: 133,738,579 H245L probably benign Het
B3galt2 A C 1: 143,646,145 R6S probably damaging Het
B4galnt2 T C 11: 95,890,985 H118R probably damaging Het
Clca3b A G 3: 144,839,111 S372P probably benign Het
Cnn1 T C 9: 22,099,420 probably null Het
Cpne6 C T 14: 55,512,603 R64C probably damaging Het
Csmd1 T A 8: 16,200,045 H973L probably damaging Het
Dennd5b A T 6: 148,999,976 H1137Q probably damaging Het
Dnah3 G T 7: 119,950,658 Y500* probably null Het
Dnajc19 A G 3: 34,078,744 V104A unknown Het
Eea1 G A 10: 95,997,039 E249K probably damaging Het
Fancc T C 13: 63,347,471 Q213R probably benign Het
Gabrr1 A G 4: 33,152,411 probably null Het
Gm21319 G T 12: 87,773,503 Y95* probably null Het
Gm6588 T A 5: 112,450,237 W217R probably damaging Het
Gm7534 T C 4: 134,202,401 T198A probably damaging Het
Hgd T A 16: 37,611,170 V113E probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Lrrcc1 T C 3: 14,537,299 C151R probably damaging Het
Marveld3 T C 8: 109,948,387 S266G possibly damaging Het
Mdn1 C T 4: 32,672,837 Q486* probably null Het
Mstn G T 1: 53,066,482 V328L probably benign Het
Ndc80 C A 17: 71,508,578 G404V probably benign Het
Nelfb T C 2: 25,200,739 R557G probably damaging Het
Nol10 T G 12: 17,369,506 V266G possibly damaging Het
Olfr1104 T A 2: 87,022,535 E3V possibly damaging Het
Olfr1465 A T 19: 13,313,832 F151Y probably damaging Het
Olfr608 A T 7: 103,470,317 I93F probably benign Het
Olfr644 A G 7: 104,068,932 L33P probably damaging Het
Olfr790 A T 10: 129,501,082 Y58F probably damaging Het
Optc C A 1: 133,901,134 A245S probably damaging Het
Pcdhb11 A G 18: 37,422,984 T456A possibly damaging Het
Pkd1 A G 17: 24,575,777 E2146G possibly damaging Het
Pkdrej A T 15: 85,817,811 I1308N probably damaging Het
Plekha3 A T 2: 76,692,662 I225F probably benign Het
Ppp1r3c A T 19: 36,734,336 D11E probably benign Het
Pprc1 A G 19: 46,065,679 D1155G unknown Het
Prcc T C 3: 87,884,925 K140E probably damaging Het
Pth1r A T 9: 110,725,161 V334D possibly damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Ric8a A G 7: 140,858,466 E206G probably benign Het
Rps17 C A 7: 81,344,912 V34L probably benign Het
Serpinb13 T C 1: 107,000,435 S262P probably damaging Het
Slc1a3 C T 15: 8,650,848 probably null Het
Slc27a5 C A 7: 12,991,163 R452S probably benign Het
Slc45a2 T A 15: 11,001,036 W74R probably damaging Het
Slc4a2 A G 5: 24,430,094 T175A probably benign Het
Sos1 C A 17: 80,398,450 G1231C possibly damaging Het
Spata32 T C 11: 103,209,317 T121A probably damaging Het
Srd5a3 T A 5: 76,153,590 F222Y probably benign Het
Stag3 T C 5: 138,291,404 Y279H probably damaging Het
Stk31 T C 6: 49,446,200 I795T possibly damaging Het
Syne2 T C 12: 76,099,423 I1665T probably damaging Het
Tas2r118 A G 6: 23,970,021 Y14H probably damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tnik T G 3: 28,532,895 M105R unknown Het
Trrap A G 5: 144,803,352 T1195A probably damaging Het
Usf1 T A 1: 171,417,533 probably null Het
Usp53 G A 3: 122,961,332 T158I probably damaging Het
Uty T C Y: 1,099,748 E1149G possibly damaging Het
Vmn2r23 G A 6: 123,742,120 V811M possibly damaging Het
Zfp663 T A 2: 165,353,038 K420N probably damaging Het
Zfp703 T C 8: 26,978,274 S91P possibly damaging Het
Zscan4-ps1 A C 7: 11,066,323 I213S probably benign Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8988:Serpinb6b UTSW 13 32978142 missense probably benign 0.45
R9037:Serpinb6b UTSW 13 32978015 nonsense probably null
R9129:Serpinb6b UTSW 13 32978156 small deletion probably benign
R9377:Serpinb6b UTSW 13 32968511 start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 32975019 missense
Predicted Primers PCR Primer
(F):5'- AGAACAGAGCTGCTCCCTAG -3'
(R):5'- CCTATATTGGCTGCAGTGGC -3'

Sequencing Primer
(F):5'- AGCTCCTCCCAGTTACCATATTAAG -3'
(R):5'- CAGCTGCAGCCTCTGTG -3'
Posted On 2021-10-11