Incidental Mutation 'R8966:Pkd1'
ID 682765
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Name polycystin 1, transient receptor poteintial channel interacting
Synonyms PC-1, polycystin-1, PC1
Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8966 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24549834-24596508 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24575777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2146 (E2146G)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000226883]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035565
AA Change: E2146G

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: E2146G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226883
Predicted Effect probably benign
Transcript: ENSMUST00000227107
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A T 1: 16,080,838 M40K possibly damaging Het
Aak1 A C 6: 86,987,252 N945T unknown Het
Abca13 C G 11: 9,628,588 D4863E probably damaging Het
Abca8a C T 11: 110,071,419 probably null Het
Alppl2 T A 1: 87,087,488 N413I probably damaging Het
Asb13 T A 13: 3,642,093 H24Q probably damaging Het
Atg9b A G 5: 24,391,202 probably null Het
Atp2b4 T A 1: 133,738,579 H245L probably benign Het
B3galt2 A C 1: 143,646,145 R6S probably damaging Het
B4galnt2 T C 11: 95,890,985 H118R probably damaging Het
Clca3b A G 3: 144,839,111 S372P probably benign Het
Cnn1 T C 9: 22,099,420 probably null Het
Cpne6 C T 14: 55,512,603 R64C probably damaging Het
Csmd1 T A 8: 16,200,045 H973L probably damaging Het
Dennd5b A T 6: 148,999,976 H1137Q probably damaging Het
Dnah3 G T 7: 119,950,658 Y500* probably null Het
Dnajc19 A G 3: 34,078,744 V104A unknown Het
Eea1 G A 10: 95,997,039 E249K probably damaging Het
Fancc T C 13: 63,347,471 Q213R probably benign Het
Gabrr1 A G 4: 33,152,411 probably null Het
Gm21319 G T 12: 87,773,503 Y95* probably null Het
Gm6588 T A 5: 112,450,237 W217R probably damaging Het
Gm7534 T C 4: 134,202,401 T198A probably damaging Het
Hgd T A 16: 37,611,170 V113E probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Lrrcc1 T C 3: 14,537,299 C151R probably damaging Het
Marveld3 T C 8: 109,948,387 S266G possibly damaging Het
Mdn1 C T 4: 32,672,837 Q486* probably null Het
Mstn G T 1: 53,066,482 V328L probably benign Het
Ndc80 C A 17: 71,508,578 G404V probably benign Het
Nelfb T C 2: 25,200,739 R557G probably damaging Het
Nol10 T G 12: 17,369,506 V266G possibly damaging Het
Olfr1104 T A 2: 87,022,535 E3V possibly damaging Het
Olfr1465 A T 19: 13,313,832 F151Y probably damaging Het
Olfr608 A T 7: 103,470,317 I93F probably benign Het
Olfr644 A G 7: 104,068,932 L33P probably damaging Het
Olfr790 A T 10: 129,501,082 Y58F probably damaging Het
Optc C A 1: 133,901,134 A245S probably damaging Het
Pcdhb11 A G 18: 37,422,984 T456A possibly damaging Het
Pkdrej A T 15: 85,817,811 I1308N probably damaging Het
Plekha3 A T 2: 76,692,662 I225F probably benign Het
Ppp1r3c A T 19: 36,734,336 D11E probably benign Het
Pprc1 A G 19: 46,065,679 D1155G unknown Het
Prcc T C 3: 87,884,925 K140E probably damaging Het
Pth1r A T 9: 110,725,161 V334D possibly damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Ric8a A G 7: 140,858,466 E206G probably benign Het
Rps17 C A 7: 81,344,912 V34L probably benign Het
Serpinb13 T C 1: 107,000,435 S262P probably damaging Het
Serpinb6b T A 13: 32,978,052 L278Q probably damaging Het
Slc1a3 C T 15: 8,650,848 probably null Het
Slc27a5 C A 7: 12,991,163 R452S probably benign Het
Slc45a2 T A 15: 11,001,036 W74R probably damaging Het
Slc4a2 A G 5: 24,430,094 T175A probably benign Het
Sos1 C A 17: 80,398,450 G1231C possibly damaging Het
Spata32 T C 11: 103,209,317 T121A probably damaging Het
Srd5a3 T A 5: 76,153,590 F222Y probably benign Het
Stag3 T C 5: 138,291,404 Y279H probably damaging Het
Stk31 T C 6: 49,446,200 I795T possibly damaging Het
Syne2 T C 12: 76,099,423 I1665T probably damaging Het
Tas2r118 A G 6: 23,970,021 Y14H probably damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tnik T G 3: 28,532,895 M105R unknown Het
Trrap A G 5: 144,803,352 T1195A probably damaging Het
Usf1 T A 1: 171,417,533 probably null Het
Usp53 G A 3: 122,961,332 T158I probably damaging Het
Uty T C Y: 1,099,748 E1149G possibly damaging Het
Vmn2r23 G A 6: 123,742,120 V811M possibly damaging Het
Zfp663 T A 2: 165,353,038 K420N probably damaging Het
Zfp703 T C 8: 26,978,274 S91P possibly damaging Het
Zscan4-ps1 A C 7: 11,066,323 I213S probably benign Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24580095 missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24565427 missense probably benign
IGL00549:Pkd1 APN 17 24572761 missense probably benign
IGL00573:Pkd1 APN 17 24594530 nonsense probably null
IGL00924:Pkd1 APN 17 24571627 nonsense probably null
IGL01319:Pkd1 APN 17 24587919 unclassified probably benign
IGL01326:Pkd1 APN 17 24576174 nonsense probably null
IGL01457:Pkd1 APN 17 24594821 splice site probably null
IGL01541:Pkd1 APN 17 24586298 missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24573128 missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24576523 missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24581292 missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24585815 missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24579746 missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24580324 missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24586004 missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24575927 missense probably benign 0.03
IGL02148:Pkd1 APN 17 24579836 missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24573623 missense probably benign 0.01
IGL02442:Pkd1 APN 17 24565226 missense probably benign 0.41
IGL02498:Pkd1 APN 17 24585779 missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24569699 missense probably benign 0.01
IGL02551:Pkd1 APN 17 24573815 missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24572811 missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24571283 missense probably benign 0.40
IGL02808:Pkd1 APN 17 24593504 missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24594515 missense probably benign 0.00
IGL02863:Pkd1 APN 17 24569752 missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24575189 missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24578115 missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24593603 critical splice donor site probably null
IGL03066:Pkd1 APN 17 24586234 missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24573818 missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24565897 missense probably benign 0.00
IGL03404:Pkd1 APN 17 24564406 missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24569511 missense probably damaging 0.99
PIT4494001:Pkd1 UTSW 17 24577801 missense probably damaging 1.00
PIT4677001:Pkd1 UTSW 17 24574029 missense possibly damaging 0.94
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0085:Pkd1 UTSW 17 24586223 missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24565071 missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24585946 missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24574792 missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0521:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0544:Pkd1 UTSW 17 24585683 missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24580138 missense probably benign 0.44
R0626:Pkd1 UTSW 17 24575575 missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24594937 missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24586032 missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24568236 missense probably benign 0.00
R1306:Pkd1 UTSW 17 24573172 missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24595132 missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24594853 missense probably benign 0.01
R1605:Pkd1 UTSW 17 24577526 missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24581640 missense probably benign
R1623:Pkd1 UTSW 17 24578269 missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24564176 missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24594485 missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24581569 missense probably benign
R1785:Pkd1 UTSW 17 24591099 missense probably benign 0.00
R1829:Pkd1 UTSW 17 24565584 missense probably benign
R1869:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24576592 splice site probably null
R1988:Pkd1 UTSW 17 24576592 splice site probably null
R1998:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24579785 missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24568684 nonsense probably null
R2054:Pkd1 UTSW 17 24574796 missense probably benign 0.00
R2061:Pkd1 UTSW 17 24569914 missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24580072 missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24580889 missense probably benign 0.01
R2301:Pkd1 UTSW 17 24574612 missense probably benign
R2655:Pkd1 UTSW 17 24576490 missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R2861:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R3000:Pkd1 UTSW 17 24594486 missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24579791 missense probably benign 0.00
R3747:Pkd1 UTSW 17 24591461 missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R3859:Pkd1 UTSW 17 24578092 splice site probably benign
R3893:Pkd1 UTSW 17 24572110 critical splice donor site probably null
R3947:Pkd1 UTSW 17 24578037 splice site probably benign
R3949:Pkd1 UTSW 17 24578037 splice site probably benign
R4176:Pkd1 UTSW 17 24587997 missense probably benign 0.17
R4199:Pkd1 UTSW 17 24570030 missense probably benign 0.41
R4225:Pkd1 UTSW 17 24593523 missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24585692 missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24576526 missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24576133 missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24565374 splice site probably null
R4903:Pkd1 UTSW 17 24572002 missense probably benign 0.30
R4910:Pkd1 UTSW 17 24572687 missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R4966:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R5040:Pkd1 UTSW 17 24571260 missense probably benign 0.02
R5042:Pkd1 UTSW 17 24569887 missense probably benign 0.00
R5088:Pkd1 UTSW 17 24590838 missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24573463 missense probably benign
R5296:Pkd1 UTSW 17 24576074 missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24594536 missense probably benign
R5356:Pkd1 UTSW 17 24593577 missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24565790 missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24565073 missense probably benign
R5383:Pkd1 UTSW 17 24574375 missense probably benign
R5622:Pkd1 UTSW 17 24574040 missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24591387 missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24569371 missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24565523 missense probably benign 0.01
R5797:Pkd1 UTSW 17 24592641 missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24580212 missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24580961 missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24569830 missense probably benign
R5906:Pkd1 UTSW 17 24572920 missense probably benign 0.16
R6047:Pkd1 UTSW 17 24595085 missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24581030 missense probably benign 0.14
R6151:Pkd1 UTSW 17 24575606 missense probably benign 0.00
R6252:Pkd1 UTSW 17 24581226 missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24580227 missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24575977 missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24569413 missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24581259 missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24573493 missense probably benign 0.05
R6865:Pkd1 UTSW 17 24576487 missense probably benign 0.43
R6999:Pkd1 UTSW 17 24578501 missense possibly damaging 0.62
R7077:Pkd1 UTSW 17 24591119 missense probably damaging 1.00
R7123:Pkd1 UTSW 17 24594768 missense possibly damaging 0.89
R7134:Pkd1 UTSW 17 24594112 missense probably damaging 0.99
R7210:Pkd1 UTSW 17 24575866 missense probably damaging 0.98
R7323:Pkd1 UTSW 17 24575051 missense probably benign 0.01
R7380:Pkd1 UTSW 17 24581642 missense probably damaging 1.00
R7407:Pkd1 UTSW 17 24594594 missense probably damaging 1.00
R7410:Pkd1 UTSW 17 24575881 missense probably damaging 1.00
R7492:Pkd1 UTSW 17 24569741 missense probably benign 0.04
R7517:Pkd1 UTSW 17 24580419 missense probably damaging 1.00
R7543:Pkd1 UTSW 17 24595253 missense probably damaging 0.99
R7560:Pkd1 UTSW 17 24573631 missense probably benign 0.33
R7615:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R7714:Pkd1 UTSW 17 24550276 missense unknown
R7718:Pkd1 UTSW 17 24586500 missense probably benign 0.15
R7731:Pkd1 UTSW 17 24573898 missense probably damaging 1.00
R7849:Pkd1 UTSW 17 24586200 missense probably damaging 0.98
R7859:Pkd1 UTSW 17 24571280 missense probably damaging 1.00
R7866:Pkd1 UTSW 17 24590907 missense probably benign 0.26
R7915:Pkd1 UTSW 17 24592656 nonsense probably null
R7991:Pkd1 UTSW 17 24572621 missense possibly damaging 0.95
R8050:Pkd1 UTSW 17 24565643 missense probably benign 0.26
R8086:Pkd1 UTSW 17 24581214 missense probably damaging 1.00
R8312:Pkd1 UTSW 17 24567128 missense probably benign 0.02
R8385:Pkd1 UTSW 17 24575728 missense possibly damaging 0.67
R8393:Pkd1 UTSW 17 24572647 missense probably damaging 0.99
R8552:Pkd1 UTSW 17 24591469 missense probably damaging 1.00
R8753:Pkd1 UTSW 17 24574202 missense probably damaging 1.00
R8822:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R8855:Pkd1 UTSW 17 24573077 missense probably damaging 1.00
R8866:Pkd1 UTSW 17 24573077 missense probably damaging 1.00
R8867:Pkd1 UTSW 17 24573833 missense probably damaging 1.00
R8960:Pkd1 UTSW 17 24576202 missense probably damaging 1.00
R9004:Pkd1 UTSW 17 24580447 missense probably benign
R9015:Pkd1 UTSW 17 24565662 nonsense probably null
R9069:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R9092:Pkd1 UTSW 17 24569373 missense possibly damaging 0.93
R9135:Pkd1 UTSW 17 24572002 missense
R9307:Pkd1 UTSW 17 24550477 missense possibly damaging 0.90
R9312:Pkd1 UTSW 17 24578390 missense probably damaging 1.00
R9313:Pkd1 UTSW 17 24594958 missense probably damaging 1.00
R9380:Pkd1 UTSW 17 24550288 missense unknown
R9383:Pkd1 UTSW 17 24575926 missense probably damaging 1.00
X0024:Pkd1 UTSW 17 24591392 missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24586164 missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24565605 missense probably benign 0.44
Z1177:Pkd1 UTSW 17 24575491 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTACCAACCGCTCAGCCAG -3'
(R):5'- GGCAGTACCATTTGAGCCATAC -3'

Sequencing Primer
(F):5'- GTAACCTACCACTGGGACTTTGG -3'
(R):5'- ATTTGAGCCATACGTCCTGG -3'
Posted On 2021-10-11