Incidental Mutation 'R8967:Olfr1208'
ID 682781
Institutional Source Beutler Lab
Gene Symbol Olfr1208
Ensembl Gene ENSMUSG00000075114
Gene Name olfactory receptor 1208
Synonyms MOR225-4, GA_x6K02T2Q125-50372411-50371485
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8967 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 88895575-88902311 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 88897500 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 32 (Y32*)
Ref Sequence ENSEMBL: ENSMUSP00000149280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099810] [ENSMUST00000214121] [ENSMUST00000214297]
AlphaFold Q8VG47
Predicted Effect probably null
Transcript: ENSMUST00000099810
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000097398
Gene: ENSMUSG00000075114
AA Change: Y32*

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.9e-48 PFAM
Pfam:7tm_1 38 284 2.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214121
AA Change: Y32*
Predicted Effect probably null
Transcript: ENSMUST00000214297
AA Change: Y32*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,292,696 S1520P probably benign Het
Abhd12 A G 2: 150,837,431 Y291H probably damaging Het
Abr C A 11: 76,479,029 S178I possibly damaging Het
Akap13 T A 7: 75,729,134 I422K possibly damaging Het
Arfgef2 A T 2: 166,835,742 T185S probably damaging Het
Arfip2 A T 7: 105,637,134 Y228N probably damaging Het
B4gat1 T C 19: 5,039,650 V225A probably damaging Het
Brf1 G A 12: 112,973,619 P183S probably damaging Het
Ceacam1 T C 7: 25,463,872 N312S possibly damaging Het
Cep135 T C 5: 76,603,318 L337P probably damaging Het
Cnppd1 A T 1: 75,136,621 C334* probably null Het
Cpxm2 A T 7: 132,059,835 Y408N probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dlx3 T C 11: 95,123,751 Y287H probably damaging Het
Dnah7a A T 1: 53,643,435 probably benign Het
Dnah9 C A 11: 66,125,112 probably null Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Ecel1 A T 1: 87,151,140 Y526N probably damaging Het
Ect2 A T 3: 27,144,983 V218E probably damaging Het
Heca A G 10: 17,914,990 probably null Het
Hsd17b7 A T 1: 169,969,116 L6* probably null Het
Irgc1 T A 7: 24,433,312 T27S probably benign Het
Lama3 A C 18: 12,532,039 I671L possibly damaging Het
Mybl2 T C 2: 163,072,886 L308P probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nphp1 G A 2: 127,740,977 P672L probably damaging Het
Oas3 G A 5: 120,758,842 H905Y probably damaging Het
Obscn A G 11: 59,081,914 V2102A probably benign Het
Olfr218 A G 1: 173,203,472 T39A probably benign Het
Olfr352 A T 2: 36,870,054 T163S probably damaging Het
Olfr47 T C 6: 43,236,139 F177S probably damaging Het
Olfr5 A G 7: 6,481,012 L48P possibly damaging Het
Pank4 C G 4: 154,970,958 H262D probably benign Het
Phkb T A 8: 86,029,434 probably benign Het
Pxylp1 G A 9: 96,825,271 T286M probably damaging Het
Pygm A T 19: 6,384,714 D79V probably damaging Het
Rapgef4 A G 2: 72,226,510 T682A possibly damaging Het
Sec24b C T 3: 129,991,435 R974Q probably damaging Het
Serpinb6e A G 13: 33,836,436 F230L possibly damaging Het
Skint6 A T 4: 112,872,504 L850* probably null Het
Slc7a11 C A 3: 50,384,115 V282L probably benign Het
Smg1 A G 7: 118,166,516 S1895P unknown Het
Tango2 A G 16: 18,347,899 probably benign Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tmem64 T A 4: 15,266,575 F208L probably damaging Het
Tpcn1 A T 5: 120,555,958 V191E probably damaging Het
Wdr63 T A 3: 146,055,640 N654Y possibly damaging Het
Zbtb41 A G 1: 139,442,849 I675V probably benign Het
Zfp180 T C 7: 24,105,301 S382P probably damaging Het
Zfp932 A G 5: 110,009,017 S194G probably benign Het
Other mutations in Olfr1208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Olfr1208 APN 2 88896977 missense probably damaging 1.00
IGL02132:Olfr1208 APN 2 88897159 missense probably benign
IGL02374:Olfr1208 APN 2 88897459 missense probably damaging 1.00
R1378:Olfr1208 UTSW 2 88897026 missense probably benign 0.01
R1570:Olfr1208 UTSW 2 88896946 missense probably damaging 1.00
R2056:Olfr1208 UTSW 2 88896761 missense probably damaging 1.00
R2092:Olfr1208 UTSW 2 88897267 missense probably damaging 0.99
R2185:Olfr1208 UTSW 2 88896703 missense probably damaging 0.99
R5223:Olfr1208 UTSW 2 88897334 missense probably benign 0.03
R5479:Olfr1208 UTSW 2 88896691 missense probably benign 0.13
R6463:Olfr1208 UTSW 2 88897118 missense probably benign 0.00
R6859:Olfr1208 UTSW 2 88896934 missense probably benign
R7347:Olfr1208 UTSW 2 88897271 missense possibly damaging 0.51
R7352:Olfr1208 UTSW 2 88896718 missense probably damaging 1.00
R7544:Olfr1208 UTSW 2 88897361 missense probably damaging 1.00
R7713:Olfr1208 UTSW 2 88897778 start gained probably benign
R7842:Olfr1208 UTSW 2 88896961 missense possibly damaging 0.89
R7869:Olfr1208 UTSW 2 88897064 missense probably benign 0.00
R8137:Olfr1208 UTSW 2 88896669 makesense probably null
R8168:Olfr1208 UTSW 2 88896776 missense probably benign 0.09
R8556:Olfr1208 UTSW 2 88897038 nonsense probably null
R9092:Olfr1208 UTSW 2 88896977 missense probably damaging 1.00
R9221:Olfr1208 UTSW 2 88896911 missense probably benign
Z1176:Olfr1208 UTSW 2 88897061 missense probably damaging 1.00
Z1177:Olfr1208 UTSW 2 88896800 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCCATTGTAGGAGATTG -3'
(R):5'- ATCTTACAGAGTCAGGGCATATAC -3'

Sequencing Primer
(F):5'- GTGTTACATTGTACCAATAGGCC -3'
(R):5'- ACAGAGTCAGGGCATATACTTTTCGG -3'
Posted On 2021-10-11