Incidental Mutation 'R8967:Oas3'
ID 682796
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name 2'-5' oligoadenylate synthetase 3
Synonyms Oasl10, 2'-5' oligoadenylate synthetase-like 10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8967 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 120753098-120777661 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 120758842 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 905 (H905Y)
Ref Sequence ENSEMBL: ENSMUSP00000035588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833] [ENSMUST00000165820]
AlphaFold Q8VI93
Predicted Effect probably damaging
Transcript: ENSMUST00000044833
AA Change: H905Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: H905Y

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165820
SMART Domains Protein: ENSMUSP00000125873
Gene: ENSMUSG00000032661

DomainStartEndE-ValueType
Pfam:OAS1_C 1 130 3.8e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,292,696 S1520P probably benign Het
Abhd12 A G 2: 150,837,431 Y291H probably damaging Het
Abr C A 11: 76,479,029 S178I possibly damaging Het
Akap13 T A 7: 75,729,134 I422K possibly damaging Het
Arfgef2 A T 2: 166,835,742 T185S probably damaging Het
Arfip2 A T 7: 105,637,134 Y228N probably damaging Het
B4gat1 T C 19: 5,039,650 V225A probably damaging Het
Brf1 G A 12: 112,973,619 P183S probably damaging Het
Ceacam1 T C 7: 25,463,872 N312S possibly damaging Het
Cep135 T C 5: 76,603,318 L337P probably damaging Het
Cnppd1 A T 1: 75,136,621 C334* probably null Het
Cpxm2 A T 7: 132,059,835 Y408N probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dlx3 T C 11: 95,123,751 Y287H probably damaging Het
Dnah7a A T 1: 53,643,435 probably benign Het
Dnah9 C A 11: 66,125,112 probably null Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Ecel1 A T 1: 87,151,140 Y526N probably damaging Het
Ect2 A T 3: 27,144,983 V218E probably damaging Het
Heca A G 10: 17,914,990 probably null Het
Hsd17b7 A T 1: 169,969,116 L6* probably null Het
Irgc1 T A 7: 24,433,312 T27S probably benign Het
Lama3 A C 18: 12,532,039 I671L possibly damaging Het
Mybl2 T C 2: 163,072,886 L308P probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nphp1 G A 2: 127,740,977 P672L probably damaging Het
Obscn A G 11: 59,081,914 V2102A probably benign Het
Olfr1208 A T 2: 88,897,500 Y32* probably null Het
Olfr218 A G 1: 173,203,472 T39A probably benign Het
Olfr352 A T 2: 36,870,054 T163S probably damaging Het
Olfr47 T C 6: 43,236,139 F177S probably damaging Het
Olfr5 A G 7: 6,481,012 L48P possibly damaging Het
Pank4 C G 4: 154,970,958 H262D probably benign Het
Phkb T A 8: 86,029,434 probably benign Het
Pxylp1 G A 9: 96,825,271 T286M probably damaging Het
Pygm A T 19: 6,384,714 D79V probably damaging Het
Rapgef4 A G 2: 72,226,510 T682A possibly damaging Het
Sec24b C T 3: 129,991,435 R974Q probably damaging Het
Serpinb6e A G 13: 33,836,436 F230L possibly damaging Het
Skint6 A T 4: 112,872,504 L850* probably null Het
Slc7a11 C A 3: 50,384,115 V282L probably benign Het
Smg1 A G 7: 118,166,516 S1895P unknown Het
Tango2 A G 16: 18,347,899 probably benign Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tmem64 T A 4: 15,266,575 F208L probably damaging Het
Tpcn1 A T 5: 120,555,958 V191E probably damaging Het
Wdr63 T A 3: 146,055,640 N654Y possibly damaging Het
Zbtb41 A G 1: 139,442,849 I675V probably benign Het
Zfp180 T C 7: 24,105,301 S382P probably damaging Het
Zfp932 A G 5: 110,009,017 S194G probably benign Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
R8022:Oas3 UTSW 5 120756966 missense possibly damaging 0.91
R8137:Oas3 UTSW 5 120777500 missense probably benign 0.07
R9124:Oas3 UTSW 5 120774105 missense probably damaging 1.00
R9287:Oas3 UTSW 5 120754689 missense probably damaging 1.00
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGCATGAGTAGGCATGG -3'
(R):5'- ATCTATGTTCTCCCCAGGGTG -3'

Sequencing Primer
(F):5'- GGTTGCACAGTTCCCTACAG -3'
(R):5'- AGGGTGGGTCTTCTGCCAAAG -3'
Posted On 2021-10-11