Incidental Mutation 'R8968:Ush2a'
ID 682825
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Name usherin
Synonyms MUSH2A, LOC269160, LOC381317, Ushrn, Ush2a, A930037M10Rik, A930011D15Rik
MMRRC Submission 068802-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.501) question?
Stock # R8968 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 187995035-188697694 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 188127956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 656 (G656E)
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000060479
AA Change: G656E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609
AA Change: G656E

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,480,429 (GRCm39) L1153* probably null Het
Adamts2 T C 11: 50,683,550 (GRCm39) I944T possibly damaging Het
Aqp9 A T 9: 71,045,485 (GRCm39) C67* probably null Het
Armt1 G T 10: 4,404,150 (GRCm39) G412W probably damaging Het
B4galt1 T C 4: 40,807,243 (GRCm39) D381G probably benign Het
Bmp5 A T 9: 75,780,579 (GRCm39) H292L probably benign Het
Brpf1 T C 6: 113,299,510 (GRCm39) F1181S probably damaging Het
Btbd7 C A 12: 102,779,025 (GRCm39) G414C probably damaging Het
Ccdc65 A T 15: 98,616,723 (GRCm39) K204* probably null Het
Cdk5 T A 5: 24,627,379 (GRCm39) K88M probably damaging Het
Cdrt4 T A 11: 62,883,634 (GRCm39) L112Q probably damaging Het
Cenpb T C 2: 131,020,547 (GRCm39) E417G unknown Het
Cep135 T C 5: 76,754,576 (GRCm39) I351T possibly damaging Het
Ces1d A T 8: 93,914,383 (GRCm39) S226R probably damaging Het
Cfap97 T A 8: 46,623,114 (GRCm39) V168E possibly damaging Het
CN725425 T C 15: 91,130,090 (GRCm39) C318R possibly damaging Het
Cnga3 T A 1: 37,300,460 (GRCm39) D393E probably benign Het
Cplane1 A T 15: 8,230,765 (GRCm39) H1014L possibly damaging Het
Cpsf1 G A 15: 76,486,169 (GRCm39) R358* probably null Het
Cyp2b23 G A 7: 26,378,963 (GRCm39) P167L probably damaging Het
Cyp2c70 A T 19: 40,142,059 (GRCm39) H477Q probably benign Het
D930020B18Rik A C 10: 121,490,721 (GRCm39) Y107S probably damaging Het
Dhrs1 A T 14: 55,978,192 (GRCm39) F216I probably benign Het
Dmgdh A T 13: 93,845,767 (GRCm39) K474* probably null Het
Dsp T C 13: 38,335,596 (GRCm39) I11T possibly damaging Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,077,444 (GRCm39) probably benign Het
Grid2 A C 6: 64,643,139 (GRCm39) H967P probably benign Het
Hc A G 2: 34,922,317 (GRCm39) I503T possibly damaging Het
Herc3 T C 6: 58,867,183 (GRCm39) L824S probably damaging Het
Hfm1 T C 5: 107,065,439 (GRCm39) D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspa1l A G 17: 35,196,230 (GRCm39) K90E possibly damaging Het
Impa2 G A 18: 67,451,497 (GRCm39) V264I probably benign Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Klhl38 C T 15: 58,185,500 (GRCm39) V410I probably benign Het
Lcn4 A G 2: 26,558,360 (GRCm39) I175T possibly damaging Het
Lipo2 C A 19: 33,726,917 (GRCm39) W40L probably damaging Het
Mgam A T 6: 40,734,745 (GRCm39) probably null Het
Myo16 T A 8: 10,619,700 (GRCm39) I1417N unknown Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4a66 T A 2: 88,531,137 (GRCm39) I179F probably benign Het
Or52e19b A T 7: 103,032,667 (GRCm39) C181S probably damaging Het
Or5j3 G A 2: 86,128,526 (GRCm39) R122H probably benign Het
Pcdha11 A G 18: 37,145,307 (GRCm39) N466S probably damaging Het
Pif1 C T 9: 65,499,076 (GRCm39) T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 110,350,420 (GRCm39) probably benign Het
Pole T C 5: 110,459,949 (GRCm39) S1118P possibly damaging Het
Ppp4r4 T C 12: 103,566,706 (GRCm39) M652T probably benign Het
Prex2 A T 1: 11,180,562 (GRCm39) K376* probably null Het
Prps1l1 A T 12: 35,035,205 (GRCm39) I107F probably damaging Het
Resf1 T A 6: 149,228,664 (GRCm39) V570D probably damaging Het
Rfc1 C T 5: 65,432,778 (GRCm39) V761I probably benign Het
Ripk4 T C 16: 97,547,203 (GRCm39) E353G probably benign Het
Robo2 C A 16: 73,767,941 (GRCm39) probably null Het
Rrm1 C T 7: 102,117,545 (GRCm39) A745V probably benign Het
Sash1 A T 10: 8,606,179 (GRCm39) V737D probably benign Het
Sel1l2 T C 2: 140,127,209 (GRCm39) K101E probably benign Het
Selenbp2 A T 3: 94,607,337 (GRCm39) I253F probably benign Het
Setd1a C T 7: 127,385,279 (GRCm39) P662L possibly damaging Het
Slc16a6 C T 11: 109,345,776 (GRCm39) V496I possibly damaging Het
Slc4a4 A T 5: 89,232,512 (GRCm39) M239L probably benign Het
Slc7a8 G C 14: 55,018,750 (GRCm39) A12G probably benign Het
Snx30 T C 4: 59,886,517 (GRCm39) S309P possibly damaging Het
Spen T C 4: 141,197,701 (GRCm39) N3389S probably benign Het
Spg11 T C 2: 121,922,687 (GRCm39) T921A probably damaging Het
Tanc2 T A 11: 105,758,400 (GRCm39) D720E possibly damaging Het
Tmprss9 A T 10: 80,730,163 (GRCm39) I688F possibly damaging Het
Trap1 A G 16: 3,862,490 (GRCm39) V596A possibly damaging Het
Ttc32 G T 12: 9,080,187 (GRCm39) R44L probably benign Het
Tusc3 T A 8: 39,597,898 (GRCm39) N288K probably benign Het
Vill T C 9: 118,892,671 (GRCm39) probably null Het
Vmn1r5 A T 6: 56,963,182 (GRCm39) R286* probably null Het
Vmn2r14 T C 5: 109,365,533 (GRCm39) T514A probably benign Het
Vmn2r32 G A 7: 7,477,204 (GRCm39) H396Y probably benign Het
Vmn2r75 A T 7: 85,820,765 (GRCm39) Y56* probably null Het
Wdfy3 C T 5: 102,011,983 (GRCm39) S2668N probably benign Het
Wdr72 G A 9: 74,059,729 (GRCm39) D392N probably benign Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188,596,875 (GRCm39) missense probably benign 0.00
IGL00391:Ush2a APN 1 188,648,258 (GRCm39) missense probably damaging 1.00
IGL00429:Ush2a APN 1 188,132,311 (GRCm39) nonsense probably null
IGL00484:Ush2a APN 1 188,514,710 (GRCm39) missense probably benign 0.00
IGL00519:Ush2a APN 1 188,176,865 (GRCm39) missense probably benign 0.03
IGL00567:Ush2a APN 1 188,697,114 (GRCm39) missense probably damaging 1.00
IGL00823:Ush2a APN 1 188,643,640 (GRCm39) missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188,090,158 (GRCm39) nonsense probably null
IGL00951:Ush2a APN 1 187,995,662 (GRCm39) missense probably benign 0.33
IGL00956:Ush2a APN 1 188,485,719 (GRCm39) missense probably damaging 0.99
IGL01096:Ush2a APN 1 188,410,574 (GRCm39) missense probably damaging 1.00
IGL01108:Ush2a APN 1 188,595,022 (GRCm39) missense probably benign 0.00
IGL01315:Ush2a APN 1 188,365,811 (GRCm39) missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188,546,550 (GRCm39) missense probably benign 0.00
IGL01324:Ush2a APN 1 188,581,189 (GRCm39) missense probably benign 0.38
IGL01326:Ush2a APN 1 187,995,518 (GRCm39) nonsense probably null
IGL01384:Ush2a APN 1 188,285,425 (GRCm39) missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188,643,819 (GRCm39) missense probably benign 0.00
IGL01518:Ush2a APN 1 188,131,982 (GRCm39) missense probably benign 0.01
IGL01585:Ush2a APN 1 188,162,924 (GRCm39) missense probably damaging 1.00
IGL01595:Ush2a APN 1 188,386,921 (GRCm39) critical splice donor site probably null
IGL01657:Ush2a APN 1 188,558,658 (GRCm39) missense probably benign 0.03
IGL01797:Ush2a APN 1 187,995,706 (GRCm39) missense probably damaging 1.00
IGL01802:Ush2a APN 1 188,169,154 (GRCm39) missense probably damaging 0.99
IGL01836:Ush2a APN 1 188,492,060 (GRCm39) splice site probably benign
IGL01938:Ush2a APN 1 188,530,042 (GRCm39) missense probably damaging 1.00
IGL01976:Ush2a APN 1 188,643,438 (GRCm39) missense probably benign 0.04
IGL02023:Ush2a APN 1 188,465,711 (GRCm39) missense probably benign 0.03
IGL02126:Ush2a APN 1 187,995,588 (GRCm39) missense probably benign 0.01
IGL02133:Ush2a APN 1 188,175,540 (GRCm39) missense probably damaging 1.00
IGL02147:Ush2a APN 1 188,596,900 (GRCm39) missense probably benign
IGL02275:Ush2a APN 1 187,995,466 (GRCm39) missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188,365,826 (GRCm39) missense probably benign 0.00
IGL02353:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02360:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02367:Ush2a APN 1 188,516,943 (GRCm39) missense probably benign
IGL02402:Ush2a APN 1 187,999,305 (GRCm39) missense probably benign 0.02
IGL02410:Ush2a APN 1 188,648,194 (GRCm39) missense probably damaging 1.00
IGL02490:Ush2a APN 1 188,542,561 (GRCm39) missense probably damaging 1.00
IGL02500:Ush2a APN 1 188,554,893 (GRCm39) missense probably damaging 1.00
IGL02511:Ush2a APN 1 188,475,884 (GRCm39) critical splice donor site probably null
IGL02517:Ush2a APN 1 188,648,195 (GRCm39) missense probably damaging 1.00
IGL02536:Ush2a APN 1 188,689,463 (GRCm39) critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188,460,530 (GRCm39) missense probably benign 0.00
IGL02610:Ush2a APN 1 188,176,663 (GRCm39) missense probably damaging 0.98
IGL02677:Ush2a APN 1 188,466,882 (GRCm39) missense probably damaging 1.00
IGL02691:Ush2a APN 1 188,466,949 (GRCm39) missense probably damaging 1.00
IGL02740:Ush2a APN 1 188,380,585 (GRCm39) missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188,090,914 (GRCm39) splice site probably null
IGL02749:Ush2a APN 1 188,679,155 (GRCm39) missense probably damaging 0.99
IGL02806:Ush2a APN 1 188,542,554 (GRCm39) nonsense probably null
IGL02870:Ush2a APN 1 188,410,555 (GRCm39) missense probably benign 0.42
IGL02894:Ush2a APN 1 188,184,043 (GRCm39) missense probably damaging 1.00
IGL02904:Ush2a APN 1 188,638,703 (GRCm39) missense probably benign 0.06
IGL03000:Ush2a APN 1 188,282,053 (GRCm39) missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188,169,147 (GRCm39) missense probably benign 0.01
IGL03036:Ush2a APN 1 188,596,818 (GRCm39) missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188,530,035 (GRCm39) missense probably damaging 1.00
IGL03230:Ush2a APN 1 188,198,390 (GRCm39) missense probably benign 0.09
IGL03278:Ush2a APN 1 188,581,313 (GRCm39) missense probably damaging 1.00
BB003:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
BB013:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
PIT4283001:Ush2a UTSW 1 188,169,064 (GRCm39) missense probably benign 0.01
R0003:Ush2a UTSW 1 188,310,688 (GRCm39) missense probably damaging 0.99
R0030:Ush2a UTSW 1 188,554,854 (GRCm39) missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188,089,085 (GRCm39) missense probably benign
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188,680,652 (GRCm39) missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0208:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0230:Ush2a UTSW 1 188,582,301 (GRCm39) missense probably damaging 1.00
R0269:Ush2a UTSW 1 188,542,373 (GRCm39) missense probably benign 0.33
R0319:Ush2a UTSW 1 188,680,571 (GRCm39) splice site probably benign
R0358:Ush2a UTSW 1 188,269,977 (GRCm39) missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188,184,016 (GRCm39) missense probably damaging 1.00
R0427:Ush2a UTSW 1 188,132,478 (GRCm39) missense probably damaging 1.00
R0437:Ush2a UTSW 1 188,643,228 (GRCm39) missense probably benign 0.00
R0462:Ush2a UTSW 1 188,643,136 (GRCm39) missense probably benign
R0510:Ush2a UTSW 1 188,466,860 (GRCm39) splice site probably benign
R0531:Ush2a UTSW 1 188,175,378 (GRCm39) missense probably benign 0.18
R0541:Ush2a UTSW 1 188,446,663 (GRCm39) splice site probably benign
R0549:Ush2a UTSW 1 188,679,150 (GRCm39) missense probably damaging 0.99
R0562:Ush2a UTSW 1 188,089,044 (GRCm39) missense probably damaging 1.00
R0636:Ush2a UTSW 1 188,554,935 (GRCm39) missense probably benign
R0662:Ush2a UTSW 1 188,083,290 (GRCm39) missense probably benign 0.26
R0685:Ush2a UTSW 1 188,132,475 (GRCm39) missense probably damaging 1.00
R0718:Ush2a UTSW 1 188,530,027 (GRCm39) missense probably damaging 1.00
R0725:Ush2a UTSW 1 188,683,722 (GRCm39) missense probably damaging 1.00
R0735:Ush2a UTSW 1 188,596,890 (GRCm39) missense probably benign 0.04
R0744:Ush2a UTSW 1 188,546,603 (GRCm39) splice site probably benign
R0765:Ush2a UTSW 1 188,680,771 (GRCm39) missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188,275,015 (GRCm39) nonsense probably null
R1067:Ush2a UTSW 1 188,282,404 (GRCm39) missense probably benign 0.35
R1072:Ush2a UTSW 1 188,460,914 (GRCm39) missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188,596,836 (GRCm39) missense probably damaging 1.00
R1099:Ush2a UTSW 1 188,380,545 (GRCm39) missense probably benign 0.06
R1104:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign
R1106:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188,485,733 (GRCm39) missense probably damaging 0.99
R1168:Ush2a UTSW 1 188,410,608 (GRCm39) missense probably benign 0.01
R1199:Ush2a UTSW 1 188,491,992 (GRCm39) missense probably benign 0.00
R1215:Ush2a UTSW 1 188,689,479 (GRCm39) missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188,184,037 (GRCm39) missense probably damaging 1.00
R1307:Ush2a UTSW 1 188,090,164 (GRCm39) missense probably damaging 1.00
R1311:Ush2a UTSW 1 188,679,342 (GRCm39) missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188,255,515 (GRCm39) splice site probably benign
R1416:Ush2a UTSW 1 188,169,080 (GRCm39) missense probably damaging 1.00
R1424:Ush2a UTSW 1 188,275,075 (GRCm39) critical splice donor site probably null
R1459:Ush2a UTSW 1 188,595,048 (GRCm39) missense probably benign 0.05
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1477:Ush2a UTSW 1 188,581,273 (GRCm39) missense probably benign 0.05
R1484:Ush2a UTSW 1 188,542,534 (GRCm39) nonsense probably null
R1490:Ush2a UTSW 1 188,092,038 (GRCm39) missense probably benign 0.24
R1510:Ush2a UTSW 1 188,380,501 (GRCm39) missense probably damaging 1.00
R1522:Ush2a UTSW 1 188,530,011 (GRCm39) missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188,491,963 (GRCm39) missense probably benign 0.17
R1618:Ush2a UTSW 1 188,546,421 (GRCm39) missense probably benign 0.29
R1636:Ush2a UTSW 1 188,198,373 (GRCm39) missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188,148,018 (GRCm39) missense probably damaging 1.00
R1660:Ush2a UTSW 1 188,648,261 (GRCm39) missense probably benign
R1676:Ush2a UTSW 1 188,460,782 (GRCm39) missense probably damaging 1.00
R1704:Ush2a UTSW 1 188,553,993 (GRCm39) missense probably damaging 1.00
R1705:Ush2a UTSW 1 188,643,738 (GRCm39) missense probably benign 0.40
R1705:Ush2a UTSW 1 188,607,066 (GRCm39) missense probably damaging 1.00
R1760:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188,460,400 (GRCm39) missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188,643,382 (GRCm39) missense probably benign 0.06
R1794:Ush2a UTSW 1 188,595,006 (GRCm39) missense probably benign 0.00
R1796:Ush2a UTSW 1 188,643,024 (GRCm39) missense probably benign 0.11
R1804:Ush2a UTSW 1 188,365,926 (GRCm39) critical splice donor site probably null
R1835:Ush2a UTSW 1 188,184,015 (GRCm39) missense probably benign 0.13
R1871:Ush2a UTSW 1 188,558,665 (GRCm39) missense probably benign 0.02
R1876:Ush2a UTSW 1 188,410,486 (GRCm39) missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188,132,177 (GRCm39) missense probably benign 0.05
R1896:Ush2a UTSW 1 188,282,206 (GRCm39) missense probably benign 0.00
R1907:Ush2a UTSW 1 188,447,261 (GRCm39) missense probably benign 0.01
R1940:Ush2a UTSW 1 188,683,758 (GRCm39) missense probably null 0.89
R1950:Ush2a UTSW 1 188,487,382 (GRCm39) missense probably damaging 1.00
R1991:Ush2a UTSW 1 188,310,729 (GRCm39) splice site probably benign
R2043:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign 0.00
R2046:Ush2a UTSW 1 188,089,124 (GRCm39) missense probably benign 0.01
R2059:Ush2a UTSW 1 188,113,746 (GRCm39) critical splice donor site probably null
R2239:Ush2a UTSW 1 188,308,411 (GRCm39) missense probably benign
R2365:Ush2a UTSW 1 188,111,188 (GRCm39) missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188,679,237 (GRCm39) missense probably damaging 1.00
R2425:Ush2a UTSW 1 188,270,001 (GRCm39) missense possibly damaging 0.82
R2519:Ush2a UTSW 1 187,999,304 (GRCm39) missense probably benign
R3039:Ush2a UTSW 1 188,643,744 (GRCm39) missense probably damaging 0.99
R3434:Ush2a UTSW 1 188,465,955 (GRCm39) missense probably damaging 1.00
R3711:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3712:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3732:Ush2a UTSW 1 188,676,957 (GRCm39) missense probably benign 0.16
R3746:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3747:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3883:Ush2a UTSW 1 187,995,579 (GRCm39) missense probably benign
R3911:Ush2a UTSW 1 188,132,151 (GRCm39) missense probably benign 0.05
R3934:Ush2a UTSW 1 187,995,708 (GRCm39) critical splice donor site probably null
R3946:Ush2a UTSW 1 188,460,701 (GRCm39) missense probably benign 0.01
R3974:Ush2a UTSW 1 188,113,698 (GRCm39) missense probably benign 0.06
R4158:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4159:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4161:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4162:Ush2a UTSW 1 188,475,877 (GRCm39) missense probably benign 0.00
R4255:Ush2a UTSW 1 188,492,040 (GRCm39) nonsense probably null
R4280:Ush2a UTSW 1 188,310,658 (GRCm39) missense probably benign 0.16
R4387:Ush2a UTSW 1 188,175,628 (GRCm39) missense probably benign 0.00
R4416:Ush2a UTSW 1 188,089,071 (GRCm39) missense probably damaging 0.97
R4494:Ush2a UTSW 1 188,285,473 (GRCm39) missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188,460,793 (GRCm39) missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188,596,822 (GRCm39) missense probably damaging 1.00
R4584:Ush2a UTSW 1 188,183,995 (GRCm39) missense probably benign 0.00
R4599:Ush2a UTSW 1 188,643,844 (GRCm39) missense probably benign 0.01
R4605:Ush2a UTSW 1 188,642,998 (GRCm39) missense probably damaging 1.00
R4632:Ush2a UTSW 1 188,128,071 (GRCm39) missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188,132,138 (GRCm39) missense probably benign 0.01
R4751:Ush2a UTSW 1 188,582,284 (GRCm39) missense probably damaging 0.98
R4770:Ush2a UTSW 1 188,282,076 (GRCm39) missense probably benign 0.25
R4771:Ush2a UTSW 1 188,529,966 (GRCm39) missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188,475,742 (GRCm39) missense probably damaging 1.00
R4821:Ush2a UTSW 1 188,485,848 (GRCm39) missense probably benign 0.32
R4857:Ush2a UTSW 1 188,269,917 (GRCm39) missense probably benign 0.01
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4898:Ush2a UTSW 1 188,358,805 (GRCm39) missense probably benign 0.37
R4993:Ush2a UTSW 1 188,642,917 (GRCm39) missense probably benign 0.03
R5035:Ush2a UTSW 1 188,643,005 (GRCm39) missense probably damaging 1.00
R5061:Ush2a UTSW 1 188,689,471 (GRCm39) missense probably benign 0.03
R5150:Ush2a UTSW 1 188,184,067 (GRCm39) missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188,607,133 (GRCm39) missense probably benign 0.21
R5212:Ush2a UTSW 1 188,176,902 (GRCm39) critical splice donor site probably null
R5252:Ush2a UTSW 1 188,553,914 (GRCm39) missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188,679,276 (GRCm39) missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188,088,995 (GRCm39) missense probably damaging 0.99
R5323:Ush2a UTSW 1 188,553,874 (GRCm39) critical splice acceptor site probably null
R5330:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5331:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5332:Ush2a UTSW 1 188,083,276 (GRCm39) missense probably damaging 1.00
R5371:Ush2a UTSW 1 188,175,267 (GRCm39) missense probably benign 0.00
R5374:Ush2a UTSW 1 188,487,403 (GRCm39) missense probably benign
R5377:Ush2a UTSW 1 188,644,320 (GRCm39) missense probably benign 0.00
R5525:Ush2a UTSW 1 188,485,803 (GRCm39) missense probably benign 0.01
R5558:Ush2a UTSW 1 188,530,024 (GRCm39) missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188,308,414 (GRCm39) missense probably damaging 1.00
R5595:Ush2a UTSW 1 188,638,695 (GRCm39) missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188,492,020 (GRCm39) missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188,132,454 (GRCm39) missense probably benign 0.00
R5743:Ush2a UTSW 1 188,169,159 (GRCm39) missense probably benign 0.01
R5779:Ush2a UTSW 1 188,175,707 (GRCm39) critical splice donor site probably null
R5795:Ush2a UTSW 1 188,175,594 (GRCm39) missense probably benign 0.34
R5897:Ush2a UTSW 1 188,553,935 (GRCm39) missense probably damaging 1.00
R5918:Ush2a UTSW 1 188,089,011 (GRCm39) missense probably benign 0.26
R6000:Ush2a UTSW 1 187,999,223 (GRCm39) nonsense probably null
R6014:Ush2a UTSW 1 188,582,237 (GRCm39) missense probably damaging 0.98
R6017:Ush2a UTSW 1 188,689,711 (GRCm39) critical splice donor site probably null
R6020:Ush2a UTSW 1 188,460,293 (GRCm39) splice site probably null
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188,689,521 (GRCm39) missense probably benign 0.06
R6083:Ush2a UTSW 1 187,999,220 (GRCm39) missense probably damaging 1.00
R6091:Ush2a UTSW 1 188,132,000 (GRCm39) missense probably damaging 1.00
R6120:Ush2a UTSW 1 188,090,800 (GRCm39) missense probably benign 0.04
R6135:Ush2a UTSW 1 188,644,303 (GRCm39) missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188,090,160 (GRCm39) missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188,460,467 (GRCm39) missense probably benign 0.00
R6180:Ush2a UTSW 1 188,132,068 (GRCm39) nonsense probably null
R6191:Ush2a UTSW 1 187,995,298 (GRCm39) nonsense probably null
R6217:Ush2a UTSW 1 188,475,651 (GRCm39) splice site probably null
R6263:Ush2a UTSW 1 188,090,839 (GRCm39) missense probably damaging 1.00
R6294:Ush2a UTSW 1 188,268,567 (GRCm39) missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188,089,043 (GRCm39) missense probably benign 0.01
R6321:Ush2a UTSW 1 188,581,243 (GRCm39) nonsense probably null
R6347:Ush2a UTSW 1 188,643,084 (GRCm39) missense probably benign
R6382:Ush2a UTSW 1 188,546,499 (GRCm39) missense probably benign 0.01
R6408:Ush2a UTSW 1 187,999,229 (GRCm39) nonsense probably null
R6418:Ush2a UTSW 1 188,360,763 (GRCm39) missense probably damaging 1.00
R6500:Ush2a UTSW 1 188,573,724 (GRCm39) missense probably benign 0.00
R6504:Ush2a UTSW 1 188,643,444 (GRCm39) missense probably benign 0.00
R6534:Ush2a UTSW 1 188,183,999 (GRCm39) nonsense probably null
R6594:Ush2a UTSW 1 188,642,995 (GRCm39) missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188,643,594 (GRCm39) missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188,255,528 (GRCm39) missense probably damaging 0.99
R6658:Ush2a UTSW 1 188,546,556 (GRCm39) missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188,485,881 (GRCm39) missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188,175,416 (GRCm39) missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188,089,031 (GRCm39) missense probably benign
R6817:Ush2a UTSW 1 188,595,061 (GRCm39) missense probably benign 0.03
R6834:Ush2a UTSW 1 188,088,989 (GRCm39) missense probably damaging 1.00
R6851:Ush2a UTSW 1 188,265,402 (GRCm39) missense probably benign 0.06
R6853:Ush2a UTSW 1 188,643,434 (GRCm39) nonsense probably null
R6867:Ush2a UTSW 1 188,643,170 (GRCm39) missense probably damaging 1.00
R6889:Ush2a UTSW 1 188,530,068 (GRCm39) missense probably damaging 1.00
R6931:Ush2a UTSW 1 188,460,580 (GRCm39) missense probably benign 0.01
R6953:Ush2a UTSW 1 187,995,342 (GRCm39) missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188,308,441 (GRCm39) missense probably damaging 1.00
R7109:Ush2a UTSW 1 188,113,681 (GRCm39) missense probably benign 0.19
R7153:Ush2a UTSW 1 188,460,681 (GRCm39) missense possibly damaging 0.93
R7176:Ush2a UTSW 1 188,269,925 (GRCm39) missense probably benign 0.00
R7182:Ush2a UTSW 1 188,485,740 (GRCm39) missense probably benign 0.01
R7201:Ush2a UTSW 1 188,606,951 (GRCm39) missense probably benign
R7223:Ush2a UTSW 1 188,542,414 (GRCm39) missense probably benign 0.09
R7231:Ush2a UTSW 1 188,491,960 (GRCm39) missense possibly damaging 0.49
R7240:Ush2a UTSW 1 188,643,858 (GRCm39) missense possibly damaging 0.83
R7263:Ush2a UTSW 1 188,175,526 (GRCm39) missense possibly damaging 0.94
R7329:Ush2a UTSW 1 188,285,395 (GRCm39) missense probably damaging 0.97
R7343:Ush2a UTSW 1 188,147,943 (GRCm39) missense probably benign 0.00
R7352:Ush2a UTSW 1 188,198,321 (GRCm39) missense probably benign 0.04
R7384:Ush2a UTSW 1 188,132,360 (GRCm39) missense probably damaging 0.99
R7391:Ush2a UTSW 1 188,694,205 (GRCm39) small deletion probably benign
R7394:Ush2a UTSW 1 188,643,613 (GRCm39) missense possibly damaging 0.83
R7403:Ush2a UTSW 1 188,365,924 (GRCm39) missense probably damaging 1.00
R7408:Ush2a UTSW 1 188,465,726 (GRCm39) missense probably benign 0.00
R7453:Ush2a UTSW 1 188,285,308 (GRCm39) missense probably damaging 1.00
R7496:Ush2a UTSW 1 188,083,284 (GRCm39) missense possibly damaging 0.50
R7552:Ush2a UTSW 1 187,999,241 (GRCm39) missense possibly damaging 0.65
R7556:Ush2a UTSW 1 188,689,690 (GRCm39) missense probably benign 0.31
R7575:Ush2a UTSW 1 188,554,885 (GRCm39) missense possibly damaging 0.90
R7578:Ush2a UTSW 1 188,282,110 (GRCm39) missense probably damaging 1.00
R7584:Ush2a UTSW 1 188,460,306 (GRCm39) critical splice acceptor site probably null
R7589:Ush2a UTSW 1 188,275,046 (GRCm39) missense probably benign 0.00
R7602:Ush2a UTSW 1 188,380,606 (GRCm39) missense probably damaging 1.00
R7670:Ush2a UTSW 1 188,516,905 (GRCm39) missense possibly damaging 0.78
R7743:Ush2a UTSW 1 188,542,376 (GRCm39) missense probably benign 0.05
R7753:Ush2a UTSW 1 188,175,603 (GRCm39) missense probably benign 0.28
R7767:Ush2a UTSW 1 188,285,457 (GRCm39) missense probably benign 0.01
R7784:Ush2a UTSW 1 188,176,789 (GRCm39) missense possibly damaging 0.55
R7831:Ush2a UTSW 1 188,492,038 (GRCm39) missense probably damaging 0.98
R7834:Ush2a UTSW 1 188,465,637 (GRCm39) nonsense probably null
R7847:Ush2a UTSW 1 188,163,005 (GRCm39) missense probably damaging 1.00
R7926:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
R7969:Ush2a UTSW 1 188,558,568 (GRCm39) missense probably benign 0.02
R7978:Ush2a UTSW 1 188,132,135 (GRCm39) missense probably benign 0.00
R7990:Ush2a UTSW 1 188,274,996 (GRCm39) missense probably benign 0.00
R8001:Ush2a UTSW 1 188,643,261 (GRCm39) missense probably damaging 0.98
R8039:Ush2a UTSW 1 188,689,570 (GRCm39) missense probably damaging 1.00
R8077:Ush2a UTSW 1 188,275,025 (GRCm39) missense probably benign 0.01
R8165:Ush2a UTSW 1 188,183,952 (GRCm39) missense possibly damaging 0.70
R8208:Ush2a UTSW 1 188,606,990 (GRCm39) missense possibly damaging 0.95
R8220:Ush2a UTSW 1 188,460,863 (GRCm39) missense probably damaging 1.00
R8270:Ush2a UTSW 1 188,176,838 (GRCm39) missense probably benign 0.06
R8316:Ush2a UTSW 1 188,178,899 (GRCm39) missense probably benign 0.01
R8347:Ush2a UTSW 1 188,679,281 (GRCm39) missense probably benign 0.02
R8360:Ush2a UTSW 1 188,198,468 (GRCm39) missense probably benign 0.01
R8362:Ush2a UTSW 1 188,689,650 (GRCm39) missense probably damaging 0.96
R8386:Ush2a UTSW 1 188,460,403 (GRCm39) missense possibly damaging 0.80
R8401:Ush2a UTSW 1 188,275,062 (GRCm39) missense probably benign 0.10
R8439:Ush2a UTSW 1 188,582,254 (GRCm39) missense probably damaging 1.00
R8465:Ush2a UTSW 1 188,147,875 (GRCm39) missense probably damaging 1.00
R8478:Ush2a UTSW 1 188,175,429 (GRCm39) missense possibly damaging 0.83
R8540:Ush2a UTSW 1 188,274,858 (GRCm39) missense probably benign 0.00
R8684:Ush2a UTSW 1 188,643,220 (GRCm39) missense possibly damaging 0.45
R8685:Ush2a UTSW 1 188,198,401 (GRCm39) missense probably damaging 1.00
R8699:Ush2a UTSW 1 188,643,574 (GRCm39) missense probably damaging 1.00
R8720:Ush2a UTSW 1 188,090,715 (GRCm39) missense probably benign 0.05
R8754:Ush2a UTSW 1 188,581,162 (GRCm39) nonsense probably null
R8756:Ush2a UTSW 1 188,644,141 (GRCm39) missense possibly damaging 0.91
R8788:Ush2a UTSW 1 188,475,816 (GRCm39) nonsense probably null
R8803:Ush2a UTSW 1 188,676,998 (GRCm39) missense probably benign
R8817:Ush2a UTSW 1 187,995,231 (GRCm39) start codon destroyed probably benign 0.00
R8837:Ush2a UTSW 1 188,485,847 (GRCm39) missense probably benign
R8880:Ush2a UTSW 1 188,460,733 (GRCm39) missense probably benign 0.11
R8902:Ush2a UTSW 1 188,175,281 (GRCm39) missense probably damaging 0.98
R8918:Ush2a UTSW 1 188,270,017 (GRCm39) missense possibly damaging 0.85
R8940:Ush2a UTSW 1 188,132,505 (GRCm39) missense probably benign 0.02
R8995:Ush2a UTSW 1 188,176,850 (GRCm39) missense probably damaging 0.98
R9011:Ush2a UTSW 1 188,638,676 (GRCm39) missense probably damaging 0.99
R9037:Ush2a UTSW 1 187,995,487 (GRCm39) missense possibly damaging 0.51
R9063:Ush2a UTSW 1 187,995,457 (GRCm39) missense probably benign 0.00
R9089:Ush2a UTSW 1 188,487,374 (GRCm39) nonsense probably null
R9096:Ush2a UTSW 1 188,198,333 (GRCm39) missense probably benign 0.00
R9118:Ush2a UTSW 1 188,386,839 (GRCm39) missense probably damaging 0.98
R9174:Ush2a UTSW 1 188,460,416 (GRCm39) missense probably damaging 0.99
R9210:Ush2a UTSW 1 188,516,866 (GRCm39) missense probably null 0.01
R9242:Ush2a UTSW 1 188,365,787 (GRCm39) missense probably damaging 1.00
R9321:Ush2a UTSW 1 188,089,148 (GRCm39) missense probably damaging 0.97
R9338:Ush2a UTSW 1 188,308,489 (GRCm39) critical splice donor site probably null
R9357:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9358:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9406:Ush2a UTSW 1 187,995,646 (GRCm39) missense probably benign 0.00
R9407:Ush2a UTSW 1 188,644,045 (GRCm39) missense probably damaging 1.00
R9428:Ush2a UTSW 1 188,175,316 (GRCm39) missense probably damaging 1.00
R9456:Ush2a UTSW 1 188,558,589 (GRCm39) missense probably benign 0.00
R9507:Ush2a UTSW 1 188,596,937 (GRCm39) nonsense probably null
R9509:Ush2a UTSW 1 188,648,440 (GRCm39) missense probably damaging 1.00
R9512:Ush2a UTSW 1 188,643,160 (GRCm39) missense probably damaging 0.99
R9564:Ush2a UTSW 1 188,268,551 (GRCm39) missense possibly damaging 0.90
R9612:Ush2a UTSW 1 188,092,063 (GRCm39) nonsense probably null
R9670:Ush2a UTSW 1 188,360,768 (GRCm39) missense probably benign 0.03
R9684:Ush2a UTSW 1 188,132,078 (GRCm39) missense possibly damaging 0.67
R9798:Ush2a UTSW 1 188,644,002 (GRCm39) missense possibly damaging 0.80
RF017:Ush2a UTSW 1 187,995,666 (GRCm39) missense probably damaging 1.00
U24488:Ush2a UTSW 1 188,162,963 (GRCm39) missense probably damaging 0.99
X0011:Ush2a UTSW 1 188,051,166 (GRCm39) missense probably benign 0.00
X0024:Ush2a UTSW 1 188,132,479 (GRCm39) missense probably damaging 1.00
X0026:Ush2a UTSW 1 188,051,222 (GRCm39) missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188,282,051 (GRCm39) missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188,679,201 (GRCm39) missense probably benign 0.26
Z1088:Ush2a UTSW 1 188,644,180 (GRCm39) missense probably benign
Z1176:Ush2a UTSW 1 188,089,038 (GRCm39) missense probably damaging 1.00
Z1177:Ush2a UTSW 1 188,644,407 (GRCm39) missense possibly damaging 0.77
Z1177:Ush2a UTSW 1 188,465,741 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGACTGACTCCATGGGTCTATTTTC -3'
(R):5'- AACATTCGCTTTGCACGAGC -3'

Sequencing Primer
(F):5'- GACTCCATGGGTCTATTTTCATTCAC -3'
(R):5'- CACGAGCACTGGCCTGAATTTTG -3'
Posted On 2021-10-11