Incidental Mutation 'R8968:Hc'
ID 682827
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Name hemolytic complement
Synonyms C5, Hfib2, He, C5a
MMRRC Submission 068802-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.492) question?
Stock # R8968 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 34873343-34951450 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34922317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 503 (I503T)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
AlphaFold P06684
PDB Structure Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028233
AA Change: I503T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: I503T

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,480,429 (GRCm39) L1153* probably null Het
Adamts2 T C 11: 50,683,550 (GRCm39) I944T possibly damaging Het
Aqp9 A T 9: 71,045,485 (GRCm39) C67* probably null Het
Armt1 G T 10: 4,404,150 (GRCm39) G412W probably damaging Het
B4galt1 T C 4: 40,807,243 (GRCm39) D381G probably benign Het
Bmp5 A T 9: 75,780,579 (GRCm39) H292L probably benign Het
Brpf1 T C 6: 113,299,510 (GRCm39) F1181S probably damaging Het
Btbd7 C A 12: 102,779,025 (GRCm39) G414C probably damaging Het
Ccdc65 A T 15: 98,616,723 (GRCm39) K204* probably null Het
Cdk5 T A 5: 24,627,379 (GRCm39) K88M probably damaging Het
Cdrt4 T A 11: 62,883,634 (GRCm39) L112Q probably damaging Het
Cenpb T C 2: 131,020,547 (GRCm39) E417G unknown Het
Cep135 T C 5: 76,754,576 (GRCm39) I351T possibly damaging Het
Ces1d A T 8: 93,914,383 (GRCm39) S226R probably damaging Het
Cfap97 T A 8: 46,623,114 (GRCm39) V168E possibly damaging Het
CN725425 T C 15: 91,130,090 (GRCm39) C318R possibly damaging Het
Cnga3 T A 1: 37,300,460 (GRCm39) D393E probably benign Het
Cplane1 A T 15: 8,230,765 (GRCm39) H1014L possibly damaging Het
Cpsf1 G A 15: 76,486,169 (GRCm39) R358* probably null Het
Cyp2b23 G A 7: 26,378,963 (GRCm39) P167L probably damaging Het
Cyp2c70 A T 19: 40,142,059 (GRCm39) H477Q probably benign Het
D930020B18Rik A C 10: 121,490,721 (GRCm39) Y107S probably damaging Het
Dhrs1 A T 14: 55,978,192 (GRCm39) F216I probably benign Het
Dmgdh A T 13: 93,845,767 (GRCm39) K474* probably null Het
Dsp T C 13: 38,335,596 (GRCm39) I11T possibly damaging Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,077,444 (GRCm39) probably benign Het
Grid2 A C 6: 64,643,139 (GRCm39) H967P probably benign Het
Herc3 T C 6: 58,867,183 (GRCm39) L824S probably damaging Het
Hfm1 T C 5: 107,065,439 (GRCm39) D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspa1l A G 17: 35,196,230 (GRCm39) K90E possibly damaging Het
Impa2 G A 18: 67,451,497 (GRCm39) V264I probably benign Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Klhl38 C T 15: 58,185,500 (GRCm39) V410I probably benign Het
Lcn4 A G 2: 26,558,360 (GRCm39) I175T possibly damaging Het
Lipo2 C A 19: 33,726,917 (GRCm39) W40L probably damaging Het
Mgam A T 6: 40,734,745 (GRCm39) probably null Het
Myo16 T A 8: 10,619,700 (GRCm39) I1417N unknown Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4a66 T A 2: 88,531,137 (GRCm39) I179F probably benign Het
Or52e19b A T 7: 103,032,667 (GRCm39) C181S probably damaging Het
Or5j3 G A 2: 86,128,526 (GRCm39) R122H probably benign Het
Pcdha11 A G 18: 37,145,307 (GRCm39) N466S probably damaging Het
Pif1 C T 9: 65,499,076 (GRCm39) T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 110,350,420 (GRCm39) probably benign Het
Pole T C 5: 110,459,949 (GRCm39) S1118P possibly damaging Het
Ppp4r4 T C 12: 103,566,706 (GRCm39) M652T probably benign Het
Prex2 A T 1: 11,180,562 (GRCm39) K376* probably null Het
Prps1l1 A T 12: 35,035,205 (GRCm39) I107F probably damaging Het
Resf1 T A 6: 149,228,664 (GRCm39) V570D probably damaging Het
Rfc1 C T 5: 65,432,778 (GRCm39) V761I probably benign Het
Ripk4 T C 16: 97,547,203 (GRCm39) E353G probably benign Het
Robo2 C A 16: 73,767,941 (GRCm39) probably null Het
Rrm1 C T 7: 102,117,545 (GRCm39) A745V probably benign Het
Sash1 A T 10: 8,606,179 (GRCm39) V737D probably benign Het
Sel1l2 T C 2: 140,127,209 (GRCm39) K101E probably benign Het
Selenbp2 A T 3: 94,607,337 (GRCm39) I253F probably benign Het
Setd1a C T 7: 127,385,279 (GRCm39) P662L possibly damaging Het
Slc16a6 C T 11: 109,345,776 (GRCm39) V496I possibly damaging Het
Slc4a4 A T 5: 89,232,512 (GRCm39) M239L probably benign Het
Slc7a8 G C 14: 55,018,750 (GRCm39) A12G probably benign Het
Snx30 T C 4: 59,886,517 (GRCm39) S309P possibly damaging Het
Spen T C 4: 141,197,701 (GRCm39) N3389S probably benign Het
Spg11 T C 2: 121,922,687 (GRCm39) T921A probably damaging Het
Tanc2 T A 11: 105,758,400 (GRCm39) D720E possibly damaging Het
Tmprss9 A T 10: 80,730,163 (GRCm39) I688F possibly damaging Het
Trap1 A G 16: 3,862,490 (GRCm39) V596A possibly damaging Het
Ttc32 G T 12: 9,080,187 (GRCm39) R44L probably benign Het
Tusc3 T A 8: 39,597,898 (GRCm39) N288K probably benign Het
Ush2a G A 1: 188,127,956 (GRCm39) G656E probably damaging Het
Vill T C 9: 118,892,671 (GRCm39) probably null Het
Vmn1r5 A T 6: 56,963,182 (GRCm39) R286* probably null Het
Vmn2r14 T C 5: 109,365,533 (GRCm39) T514A probably benign Het
Vmn2r32 G A 7: 7,477,204 (GRCm39) H396Y probably benign Het
Vmn2r75 A T 7: 85,820,765 (GRCm39) Y56* probably null Het
Wdfy3 C T 5: 102,011,983 (GRCm39) S2668N probably benign Het
Wdr72 G A 9: 74,059,729 (GRCm39) D392N probably benign Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34,881,641 (GRCm39) missense probably benign 0.00
IGL00922:Hc APN 2 34,881,680 (GRCm39) missense probably damaging 1.00
IGL01523:Hc APN 2 34,929,250 (GRCm39) missense probably benign 0.04
IGL01746:Hc APN 2 34,947,338 (GRCm39) missense probably damaging 0.98
IGL01793:Hc APN 2 34,918,202 (GRCm39) missense probably damaging 1.00
IGL01972:Hc APN 2 34,873,784 (GRCm39) missense probably damaging 1.00
IGL02037:Hc APN 2 34,903,531 (GRCm39) missense probably benign 0.16
IGL02048:Hc APN 2 34,886,039 (GRCm39) missense probably benign 0.00
IGL02227:Hc APN 2 34,899,923 (GRCm39) intron probably benign
IGL02230:Hc APN 2 34,903,682 (GRCm39) missense probably benign
IGL02254:Hc APN 2 34,874,836 (GRCm39) missense probably damaging 1.00
IGL02363:Hc APN 2 34,890,847 (GRCm39) missense probably benign
IGL02650:Hc APN 2 34,890,886 (GRCm39) missense possibly damaging 0.49
IGL03053:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03168:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03341:Hc APN 2 34,893,389 (GRCm39) missense probably damaging 0.98
PIT4142001:Hc UTSW 2 34,921,833 (GRCm39) splice site probably benign
PIT4378001:Hc UTSW 2 34,921,876 (GRCm39) missense probably benign 0.13
PIT4508001:Hc UTSW 2 34,874,816 (GRCm39) missense probably damaging 0.96
PIT4812001:Hc UTSW 2 34,919,464 (GRCm39) missense probably benign 0.16
R0025:Hc UTSW 2 34,876,304 (GRCm39) missense probably damaging 1.00
R0053:Hc UTSW 2 34,947,287 (GRCm39) missense probably benign 0.32
R0197:Hc UTSW 2 34,874,762 (GRCm39) missense probably damaging 1.00
R0218:Hc UTSW 2 34,918,086 (GRCm39) missense probably damaging 1.00
R0242:Hc UTSW 2 34,926,166 (GRCm39) splice site probably benign
R0496:Hc UTSW 2 34,903,583 (GRCm39) missense probably damaging 1.00
R1205:Hc UTSW 2 34,893,536 (GRCm39) missense possibly damaging 0.50
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1574:Hc UTSW 2 34,890,777 (GRCm39) intron probably benign
R1610:Hc UTSW 2 34,896,173 (GRCm39) missense probably benign 0.44
R1640:Hc UTSW 2 34,947,336 (GRCm39) nonsense probably null
R1887:Hc UTSW 2 34,924,623 (GRCm39) missense probably benign
R1920:Hc UTSW 2 34,919,407 (GRCm39) splice site probably benign
R2018:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2019:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2151:Hc UTSW 2 34,881,115 (GRCm39) intron probably benign
R2366:Hc UTSW 2 34,903,648 (GRCm39) missense probably benign
R4093:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R4288:Hc UTSW 2 34,920,414 (GRCm39) missense probably damaging 0.98
R4501:Hc UTSW 2 34,887,488 (GRCm39) splice site probably null
R4502:Hc UTSW 2 34,896,264 (GRCm39) missense probably benign 0.00
R4508:Hc UTSW 2 34,903,077 (GRCm39) missense possibly damaging 0.94
R4583:Hc UTSW 2 34,918,189 (GRCm39) missense probably benign 0.00
R4686:Hc UTSW 2 34,929,260 (GRCm39) missense possibly damaging 0.49
R4776:Hc UTSW 2 34,929,746 (GRCm39) missense probably benign 0.12
R4846:Hc UTSW 2 34,909,682 (GRCm39) missense probably benign 0.00
R5032:Hc UTSW 2 34,903,544 (GRCm39) missense probably benign 0.07
R5089:Hc UTSW 2 34,914,902 (GRCm39) missense probably benign 0.01
R5289:Hc UTSW 2 34,886,026 (GRCm39) critical splice donor site probably null
R5347:Hc UTSW 2 34,927,636 (GRCm39) missense probably benign 0.04
R5356:Hc UTSW 2 34,885,007 (GRCm39) missense probably benign 0.00
R5379:Hc UTSW 2 34,881,077 (GRCm39) missense probably damaging 1.00
R5403:Hc UTSW 2 34,947,446 (GRCm39) missense probably damaging 1.00
R5418:Hc UTSW 2 34,898,195 (GRCm39) critical splice donor site probably null
R5450:Hc UTSW 2 34,903,050 (GRCm39) missense possibly damaging 0.67
R5494:Hc UTSW 2 34,893,551 (GRCm39) splice site probably null
R5713:Hc UTSW 2 34,903,543 (GRCm39) missense probably damaging 0.99
R5898:Hc UTSW 2 34,887,449 (GRCm39) missense probably benign 0.06
R5925:Hc UTSW 2 34,920,462 (GRCm39) missense possibly damaging 0.92
R5942:Hc UTSW 2 34,918,137 (GRCm39) nonsense probably null
R5991:Hc UTSW 2 34,896,117 (GRCm39) missense possibly damaging 0.91
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6115:Hc UTSW 2 34,903,050 (GRCm39) missense probably damaging 1.00
R6234:Hc UTSW 2 34,918,058 (GRCm39) missense probably benign
R6264:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
R6313:Hc UTSW 2 34,879,851 (GRCm39) splice site probably null
R6525:Hc UTSW 2 34,881,236 (GRCm39) missense probably benign 0.06
R6577:Hc UTSW 2 34,922,138 (GRCm39) missense probably benign 0.00
R6601:Hc UTSW 2 34,935,906 (GRCm39) missense probably benign 0.03
R6916:Hc UTSW 2 34,900,044 (GRCm39) nonsense probably null
R7108:Hc UTSW 2 34,929,706 (GRCm39) missense probably benign 0.03
R7143:Hc UTSW 2 34,940,450 (GRCm39) missense probably benign 0.00
R7388:Hc UTSW 2 34,874,859 (GRCm39) splice site probably null
R7468:Hc UTSW 2 34,918,063 (GRCm39) missense probably benign 0.00
R7504:Hc UTSW 2 34,951,331 (GRCm39) missense not run
R7521:Hc UTSW 2 34,935,344 (GRCm39) missense possibly damaging 0.80
R7582:Hc UTSW 2 34,881,278 (GRCm39) missense possibly damaging 0.70
R7596:Hc UTSW 2 34,890,859 (GRCm39) missense probably damaging 0.96
R7599:Hc UTSW 2 34,940,431 (GRCm39) missense probably damaging 1.00
R7692:Hc UTSW 2 34,914,161 (GRCm39) missense probably damaging 1.00
R7853:Hc UTSW 2 34,900,045 (GRCm39) missense probably damaging 1.00
R7877:Hc UTSW 2 34,887,411 (GRCm39) nonsense probably null
R8329:Hc UTSW 2 34,902,910 (GRCm39) splice site probably null
R8375:Hc UTSW 2 34,873,731 (GRCm39) missense probably benign 0.32
R8477:Hc UTSW 2 34,879,182 (GRCm39) missense probably damaging 1.00
R8810:Hc UTSW 2 34,909,535 (GRCm39) missense probably benign 0.06
R8888:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8895:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8969:Hc UTSW 2 34,909,475 (GRCm39) critical splice donor site probably null
R9146:Hc UTSW 2 34,924,571 (GRCm39) missense probably damaging 1.00
R9218:Hc UTSW 2 34,922,203 (GRCm39) missense probably damaging 1.00
R9340:Hc UTSW 2 34,876,294 (GRCm39) missense probably damaging 0.99
R9396:Hc UTSW 2 34,927,615 (GRCm39) nonsense probably null
R9569:Hc UTSW 2 34,926,359 (GRCm39) missense probably benign 0.00
R9576:Hc UTSW 2 34,873,767 (GRCm39) missense probably benign 0.01
R9706:Hc UTSW 2 34,914,196 (GRCm39) missense probably damaging 1.00
X0066:Hc UTSW 2 34,873,723 (GRCm39) missense probably damaging 1.00
Z1088:Hc UTSW 2 34,919,482 (GRCm39) missense probably benign 0.02
Z1088:Hc UTSW 2 34,898,261 (GRCm39) missense possibly damaging 0.94
Z1176:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
Z1177:Hc UTSW 2 34,903,622 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCGTCAGCCACTAATTCTG -3'
(R):5'- CATGAGAGCATGTATGTAGGTACA -3'

Sequencing Primer
(F):5'- GTCAGCCACTAATTCTGCTGTTTG -3'
(R):5'- AACTCTGTTGTGCCAAGAGC -3'
Posted On 2021-10-11