Incidental Mutation 'R8968:Spg11'
ID 682830
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene Name SPG11, spatacsin vesicle trafficking associated
Synonyms 6030465E24Rik, C530005A01Rik, spastic paraplegia 11
MMRRC Submission 068802-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R8968 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 121884001-121948867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121922687 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 921 (T921A)
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036450]
AlphaFold Q3UHA3
Predicted Effect probably damaging
Transcript: ENSMUST00000036450
AA Change: T921A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: T921A

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,480,429 (GRCm39) L1153* probably null Het
Adamts2 T C 11: 50,683,550 (GRCm39) I944T possibly damaging Het
Aqp9 A T 9: 71,045,485 (GRCm39) C67* probably null Het
Armt1 G T 10: 4,404,150 (GRCm39) G412W probably damaging Het
B4galt1 T C 4: 40,807,243 (GRCm39) D381G probably benign Het
Bmp5 A T 9: 75,780,579 (GRCm39) H292L probably benign Het
Brpf1 T C 6: 113,299,510 (GRCm39) F1181S probably damaging Het
Btbd7 C A 12: 102,779,025 (GRCm39) G414C probably damaging Het
Ccdc65 A T 15: 98,616,723 (GRCm39) K204* probably null Het
Cdk5 T A 5: 24,627,379 (GRCm39) K88M probably damaging Het
Cdrt4 T A 11: 62,883,634 (GRCm39) L112Q probably damaging Het
Cenpb T C 2: 131,020,547 (GRCm39) E417G unknown Het
Cep135 T C 5: 76,754,576 (GRCm39) I351T possibly damaging Het
Ces1d A T 8: 93,914,383 (GRCm39) S226R probably damaging Het
Cfap97 T A 8: 46,623,114 (GRCm39) V168E possibly damaging Het
CN725425 T C 15: 91,130,090 (GRCm39) C318R possibly damaging Het
Cnga3 T A 1: 37,300,460 (GRCm39) D393E probably benign Het
Cplane1 A T 15: 8,230,765 (GRCm39) H1014L possibly damaging Het
Cpsf1 G A 15: 76,486,169 (GRCm39) R358* probably null Het
Cyp2b23 G A 7: 26,378,963 (GRCm39) P167L probably damaging Het
Cyp2c70 A T 19: 40,142,059 (GRCm39) H477Q probably benign Het
D930020B18Rik A C 10: 121,490,721 (GRCm39) Y107S probably damaging Het
Dhrs1 A T 14: 55,978,192 (GRCm39) F216I probably benign Het
Dmgdh A T 13: 93,845,767 (GRCm39) K474* probably null Het
Dsp T C 13: 38,335,596 (GRCm39) I11T possibly damaging Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,077,444 (GRCm39) probably benign Het
Grid2 A C 6: 64,643,139 (GRCm39) H967P probably benign Het
Hc A G 2: 34,922,317 (GRCm39) I503T possibly damaging Het
Herc3 T C 6: 58,867,183 (GRCm39) L824S probably damaging Het
Hfm1 T C 5: 107,065,439 (GRCm39) D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspa1l A G 17: 35,196,230 (GRCm39) K90E possibly damaging Het
Impa2 G A 18: 67,451,497 (GRCm39) V264I probably benign Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Klhl38 C T 15: 58,185,500 (GRCm39) V410I probably benign Het
Lcn4 A G 2: 26,558,360 (GRCm39) I175T possibly damaging Het
Lipo2 C A 19: 33,726,917 (GRCm39) W40L probably damaging Het
Mgam A T 6: 40,734,745 (GRCm39) probably null Het
Myo16 T A 8: 10,619,700 (GRCm39) I1417N unknown Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4a66 T A 2: 88,531,137 (GRCm39) I179F probably benign Het
Or52e19b A T 7: 103,032,667 (GRCm39) C181S probably damaging Het
Or5j3 G A 2: 86,128,526 (GRCm39) R122H probably benign Het
Pcdha11 A G 18: 37,145,307 (GRCm39) N466S probably damaging Het
Pif1 C T 9: 65,499,076 (GRCm39) T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 110,350,420 (GRCm39) probably benign Het
Pole T C 5: 110,459,949 (GRCm39) S1118P possibly damaging Het
Ppp4r4 T C 12: 103,566,706 (GRCm39) M652T probably benign Het
Prex2 A T 1: 11,180,562 (GRCm39) K376* probably null Het
Prps1l1 A T 12: 35,035,205 (GRCm39) I107F probably damaging Het
Resf1 T A 6: 149,228,664 (GRCm39) V570D probably damaging Het
Rfc1 C T 5: 65,432,778 (GRCm39) V761I probably benign Het
Ripk4 T C 16: 97,547,203 (GRCm39) E353G probably benign Het
Robo2 C A 16: 73,767,941 (GRCm39) probably null Het
Rrm1 C T 7: 102,117,545 (GRCm39) A745V probably benign Het
Sash1 A T 10: 8,606,179 (GRCm39) V737D probably benign Het
Sel1l2 T C 2: 140,127,209 (GRCm39) K101E probably benign Het
Selenbp2 A T 3: 94,607,337 (GRCm39) I253F probably benign Het
Setd1a C T 7: 127,385,279 (GRCm39) P662L possibly damaging Het
Slc16a6 C T 11: 109,345,776 (GRCm39) V496I possibly damaging Het
Slc4a4 A T 5: 89,232,512 (GRCm39) M239L probably benign Het
Slc7a8 G C 14: 55,018,750 (GRCm39) A12G probably benign Het
Snx30 T C 4: 59,886,517 (GRCm39) S309P possibly damaging Het
Spen T C 4: 141,197,701 (GRCm39) N3389S probably benign Het
Tanc2 T A 11: 105,758,400 (GRCm39) D720E possibly damaging Het
Tmprss9 A T 10: 80,730,163 (GRCm39) I688F possibly damaging Het
Trap1 A G 16: 3,862,490 (GRCm39) V596A possibly damaging Het
Ttc32 G T 12: 9,080,187 (GRCm39) R44L probably benign Het
Tusc3 T A 8: 39,597,898 (GRCm39) N288K probably benign Het
Ush2a G A 1: 188,127,956 (GRCm39) G656E probably damaging Het
Vill T C 9: 118,892,671 (GRCm39) probably null Het
Vmn1r5 A T 6: 56,963,182 (GRCm39) R286* probably null Het
Vmn2r14 T C 5: 109,365,533 (GRCm39) T514A probably benign Het
Vmn2r32 G A 7: 7,477,204 (GRCm39) H396Y probably benign Het
Vmn2r75 A T 7: 85,820,765 (GRCm39) Y56* probably null Het
Wdfy3 C T 5: 102,011,983 (GRCm39) S2668N probably benign Het
Wdr72 G A 9: 74,059,729 (GRCm39) D392N probably benign Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 121,896,041 (GRCm39) missense probably damaging 0.96
IGL00495:Spg11 APN 2 121,924,937 (GRCm39) critical splice donor site probably null
IGL00757:Spg11 APN 2 121,901,440 (GRCm39) missense probably benign 0.05
IGL01304:Spg11 APN 2 121,902,771 (GRCm39) missense probably damaging 1.00
IGL01355:Spg11 APN 2 121,943,637 (GRCm39) missense probably benign
IGL01626:Spg11 APN 2 121,891,452 (GRCm39) missense probably damaging 0.98
IGL01739:Spg11 APN 2 121,945,152 (GRCm39) missense probably damaging 1.00
IGL01835:Spg11 APN 2 121,918,705 (GRCm39) missense probably benign 0.36
IGL02129:Spg11 APN 2 121,926,167 (GRCm39) missense probably damaging 0.99
IGL02178:Spg11 APN 2 121,927,783 (GRCm39) missense probably damaging 1.00
IGL02199:Spg11 APN 2 121,890,034 (GRCm39) missense probably damaging 1.00
IGL02212:Spg11 APN 2 121,938,638 (GRCm39) missense probably benign 0.31
IGL02605:Spg11 APN 2 121,922,741 (GRCm39) missense probably benign 0.00
IGL02635:Spg11 APN 2 121,943,549 (GRCm39) missense possibly damaging 0.52
IGL02743:Spg11 APN 2 121,889,988 (GRCm39) missense probably damaging 0.97
IGL02822:Spg11 APN 2 121,905,015 (GRCm39) missense probably damaging 0.99
IGL02992:Spg11 APN 2 121,888,879 (GRCm39) missense probably damaging 1.00
IGL03010:Spg11 APN 2 121,918,801 (GRCm39) missense probably damaging 0.96
3-1:Spg11 UTSW 2 121,917,371 (GRCm39) missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 121,918,666 (GRCm39) missense probably damaging 0.98
R0131:Spg11 UTSW 2 121,901,449 (GRCm39) missense probably damaging 1.00
R0206:Spg11 UTSW 2 121,886,177 (GRCm39) critical splice donor site probably null
R0208:Spg11 UTSW 2 121,886,177 (GRCm39) critical splice donor site probably null
R0302:Spg11 UTSW 2 121,922,668 (GRCm39) missense possibly damaging 0.90
R0347:Spg11 UTSW 2 121,927,850 (GRCm39) missense probably damaging 0.99
R0357:Spg11 UTSW 2 121,896,713 (GRCm39) splice site probably benign
R0372:Spg11 UTSW 2 121,889,928 (GRCm39) frame shift probably null
R0715:Spg11 UTSW 2 121,915,464 (GRCm39) missense probably benign 0.03
R0927:Spg11 UTSW 2 121,924,968 (GRCm39) missense probably damaging 0.99
R1163:Spg11 UTSW 2 121,901,422 (GRCm39) missense probably damaging 1.00
R1534:Spg11 UTSW 2 121,922,806 (GRCm39) missense probably damaging 1.00
R1555:Spg11 UTSW 2 121,927,858 (GRCm39) missense probably damaging 0.99
R1569:Spg11 UTSW 2 121,932,187 (GRCm39) missense probably damaging 0.99
R1840:Spg11 UTSW 2 121,932,237 (GRCm39) missense probably damaging 1.00
R1929:Spg11 UTSW 2 121,890,688 (GRCm39) missense probably damaging 1.00
R2265:Spg11 UTSW 2 121,938,788 (GRCm39) missense possibly damaging 0.48
R2303:Spg11 UTSW 2 121,899,318 (GRCm39) missense probably damaging 0.99
R2510:Spg11 UTSW 2 121,905,791 (GRCm39) missense probably benign 0.03
R2760:Spg11 UTSW 2 121,927,840 (GRCm39) missense probably damaging 0.99
R2918:Spg11 UTSW 2 121,905,782 (GRCm39) missense probably damaging 0.99
R3195:Spg11 UTSW 2 121,913,879 (GRCm39) critical splice donor site probably null
R3423:Spg11 UTSW 2 121,901,534 (GRCm39) missense probably benign 0.00
R4353:Spg11 UTSW 2 121,943,675 (GRCm39) missense possibly damaging 0.92
R4407:Spg11 UTSW 2 121,905,813 (GRCm39) missense probably benign 0.00
R4644:Spg11 UTSW 2 121,891,510 (GRCm39) missense probably benign 0.03
R4663:Spg11 UTSW 2 121,928,580 (GRCm39) critical splice donor site probably null
R4684:Spg11 UTSW 2 121,895,557 (GRCm39) missense probably damaging 1.00
R4771:Spg11 UTSW 2 121,895,963 (GRCm39) nonsense probably null
R4810:Spg11 UTSW 2 121,890,277 (GRCm39) missense probably damaging 1.00
R4829:Spg11 UTSW 2 121,938,936 (GRCm39) missense probably benign 0.44
R5089:Spg11 UTSW 2 121,945,198 (GRCm39) nonsense probably null
R5362:Spg11 UTSW 2 121,891,481 (GRCm39) missense probably damaging 0.99
R5684:Spg11 UTSW 2 121,923,984 (GRCm39) missense probably damaging 1.00
R5899:Spg11 UTSW 2 121,928,680 (GRCm39) missense possibly damaging 0.67
R5923:Spg11 UTSW 2 121,923,959 (GRCm39) missense probably damaging 0.98
R6052:Spg11 UTSW 2 121,927,837 (GRCm39) missense probably damaging 0.99
R6111:Spg11 UTSW 2 121,923,963 (GRCm39) missense probably damaging 0.98
R6174:Spg11 UTSW 2 121,917,286 (GRCm39) splice site probably null
R6226:Spg11 UTSW 2 121,918,743 (GRCm39) missense possibly damaging 0.69
R6336:Spg11 UTSW 2 121,943,440 (GRCm39) splice site probably null
R6480:Spg11 UTSW 2 121,922,786 (GRCm39) missense probably benign 0.03
R6494:Spg11 UTSW 2 121,943,706 (GRCm39) missense probably damaging 0.98
R6582:Spg11 UTSW 2 121,922,773 (GRCm39) missense probably damaging 0.99
R6714:Spg11 UTSW 2 121,926,212 (GRCm39) missense probably damaging 0.99
R6791:Spg11 UTSW 2 121,923,924 (GRCm39) missense probably damaging 0.99
R6836:Spg11 UTSW 2 121,890,016 (GRCm39) missense probably damaging 1.00
R6928:Spg11 UTSW 2 121,900,385 (GRCm39) missense probably benign 0.37
R7179:Spg11 UTSW 2 121,932,270 (GRCm39) splice site probably null
R7229:Spg11 UTSW 2 121,938,585 (GRCm39) missense probably damaging 0.98
R7337:Spg11 UTSW 2 121,915,474 (GRCm39) missense probably benign 0.09
R7338:Spg11 UTSW 2 121,885,858 (GRCm39) missense probably damaging 1.00
R7351:Spg11 UTSW 2 121,900,412 (GRCm39) missense possibly damaging 0.95
R7378:Spg11 UTSW 2 121,888,910 (GRCm39) missense probably damaging 1.00
R7448:Spg11 UTSW 2 121,924,026 (GRCm39) critical splice acceptor site probably null
R7505:Spg11 UTSW 2 121,905,832 (GRCm39) nonsense probably null
R7665:Spg11 UTSW 2 121,896,748 (GRCm39) missense probably damaging 0.99
R7685:Spg11 UTSW 2 121,899,361 (GRCm39) missense probably damaging 0.99
R7779:Spg11 UTSW 2 121,901,420 (GRCm39) missense probably damaging 1.00
R7947:Spg11 UTSW 2 121,922,803 (GRCm39) missense probably damaging 1.00
R7958:Spg11 UTSW 2 121,923,426 (GRCm39) splice site probably null
R8024:Spg11 UTSW 2 121,927,802 (GRCm39) missense possibly damaging 0.67
R8033:Spg11 UTSW 2 121,917,432 (GRCm39) missense probably damaging 1.00
R8069:Spg11 UTSW 2 121,943,637 (GRCm39) missense probably benign
R8121:Spg11 UTSW 2 121,900,348 (GRCm39) critical splice donor site probably null
R8252:Spg11 UTSW 2 121,918,820 (GRCm39) splice site probably benign
R8358:Spg11 UTSW 2 121,910,739 (GRCm39) missense possibly damaging 0.69
R8362:Spg11 UTSW 2 121,948,842 (GRCm39) missense unknown
R8385:Spg11 UTSW 2 121,927,802 (GRCm39) missense probably benign 0.22
R8406:Spg11 UTSW 2 121,923,923 (GRCm39) missense probably damaging 0.99
R8480:Spg11 UTSW 2 121,943,560 (GRCm39) missense probably damaging 1.00
R8810:Spg11 UTSW 2 121,901,425 (GRCm39) missense probably damaging 0.98
R8883:Spg11 UTSW 2 121,943,561 (GRCm39) missense probably damaging 1.00
R9008:Spg11 UTSW 2 121,900,413 (GRCm39) missense probably benign 0.05
R9059:Spg11 UTSW 2 121,918,788 (GRCm39) missense probably damaging 0.99
R9296:Spg11 UTSW 2 121,945,175 (GRCm39) missense probably benign 0.34
R9333:Spg11 UTSW 2 121,932,244 (GRCm39) missense probably damaging 0.99
R9657:Spg11 UTSW 2 121,910,781 (GRCm39) missense probably damaging 1.00
R9774:Spg11 UTSW 2 121,938,965 (GRCm39) missense probably damaging 0.99
Z1177:Spg11 UTSW 2 121,903,466 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTATGTCGGAGCAACACTG -3'
(R):5'- TTCATGTAGAATACAAAGCGCG -3'

Sequencing Primer
(F):5'- ACACTGCACTGAACTGGTG -3'
(R):5'- GTAGAATACAAAGCGCGCTCCC -3'
Posted On 2021-10-11