Incidental Mutation 'R8968:Spen'
ID 682837
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
MMRRC Submission 068802-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8968 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141195201-141265908 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141197701 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 3389 (N3389S)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006377
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078886
AA Change: N3366S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: N3366S

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
AA Change: N3389S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: N3389S

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,480,429 (GRCm39) L1153* probably null Het
Adamts2 T C 11: 50,683,550 (GRCm39) I944T possibly damaging Het
Aqp9 A T 9: 71,045,485 (GRCm39) C67* probably null Het
Armt1 G T 10: 4,404,150 (GRCm39) G412W probably damaging Het
B4galt1 T C 4: 40,807,243 (GRCm39) D381G probably benign Het
Bmp5 A T 9: 75,780,579 (GRCm39) H292L probably benign Het
Brpf1 T C 6: 113,299,510 (GRCm39) F1181S probably damaging Het
Btbd7 C A 12: 102,779,025 (GRCm39) G414C probably damaging Het
Ccdc65 A T 15: 98,616,723 (GRCm39) K204* probably null Het
Cdk5 T A 5: 24,627,379 (GRCm39) K88M probably damaging Het
Cdrt4 T A 11: 62,883,634 (GRCm39) L112Q probably damaging Het
Cenpb T C 2: 131,020,547 (GRCm39) E417G unknown Het
Cep135 T C 5: 76,754,576 (GRCm39) I351T possibly damaging Het
Ces1d A T 8: 93,914,383 (GRCm39) S226R probably damaging Het
Cfap97 T A 8: 46,623,114 (GRCm39) V168E possibly damaging Het
CN725425 T C 15: 91,130,090 (GRCm39) C318R possibly damaging Het
Cnga3 T A 1: 37,300,460 (GRCm39) D393E probably benign Het
Cplane1 A T 15: 8,230,765 (GRCm39) H1014L possibly damaging Het
Cpsf1 G A 15: 76,486,169 (GRCm39) R358* probably null Het
Cyp2b23 G A 7: 26,378,963 (GRCm39) P167L probably damaging Het
Cyp2c70 A T 19: 40,142,059 (GRCm39) H477Q probably benign Het
D930020B18Rik A C 10: 121,490,721 (GRCm39) Y107S probably damaging Het
Dhrs1 A T 14: 55,978,192 (GRCm39) F216I probably benign Het
Dmgdh A T 13: 93,845,767 (GRCm39) K474* probably null Het
Dsp T C 13: 38,335,596 (GRCm39) I11T possibly damaging Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,077,444 (GRCm39) probably benign Het
Grid2 A C 6: 64,643,139 (GRCm39) H967P probably benign Het
Hc A G 2: 34,922,317 (GRCm39) I503T possibly damaging Het
Herc3 T C 6: 58,867,183 (GRCm39) L824S probably damaging Het
Hfm1 T C 5: 107,065,439 (GRCm39) D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspa1l A G 17: 35,196,230 (GRCm39) K90E possibly damaging Het
Impa2 G A 18: 67,451,497 (GRCm39) V264I probably benign Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Klhl38 C T 15: 58,185,500 (GRCm39) V410I probably benign Het
Lcn4 A G 2: 26,558,360 (GRCm39) I175T possibly damaging Het
Lipo2 C A 19: 33,726,917 (GRCm39) W40L probably damaging Het
Mgam A T 6: 40,734,745 (GRCm39) probably null Het
Myo16 T A 8: 10,619,700 (GRCm39) I1417N unknown Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4a66 T A 2: 88,531,137 (GRCm39) I179F probably benign Het
Or52e19b A T 7: 103,032,667 (GRCm39) C181S probably damaging Het
Or5j3 G A 2: 86,128,526 (GRCm39) R122H probably benign Het
Pcdha11 A G 18: 37,145,307 (GRCm39) N466S probably damaging Het
Pif1 C T 9: 65,499,076 (GRCm39) T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 110,350,420 (GRCm39) probably benign Het
Pole T C 5: 110,459,949 (GRCm39) S1118P possibly damaging Het
Ppp4r4 T C 12: 103,566,706 (GRCm39) M652T probably benign Het
Prex2 A T 1: 11,180,562 (GRCm39) K376* probably null Het
Prps1l1 A T 12: 35,035,205 (GRCm39) I107F probably damaging Het
Resf1 T A 6: 149,228,664 (GRCm39) V570D probably damaging Het
Rfc1 C T 5: 65,432,778 (GRCm39) V761I probably benign Het
Ripk4 T C 16: 97,547,203 (GRCm39) E353G probably benign Het
Robo2 C A 16: 73,767,941 (GRCm39) probably null Het
Rrm1 C T 7: 102,117,545 (GRCm39) A745V probably benign Het
Sash1 A T 10: 8,606,179 (GRCm39) V737D probably benign Het
Sel1l2 T C 2: 140,127,209 (GRCm39) K101E probably benign Het
Selenbp2 A T 3: 94,607,337 (GRCm39) I253F probably benign Het
Setd1a C T 7: 127,385,279 (GRCm39) P662L possibly damaging Het
Slc16a6 C T 11: 109,345,776 (GRCm39) V496I possibly damaging Het
Slc4a4 A T 5: 89,232,512 (GRCm39) M239L probably benign Het
Slc7a8 G C 14: 55,018,750 (GRCm39) A12G probably benign Het
Snx30 T C 4: 59,886,517 (GRCm39) S309P possibly damaging Het
Spg11 T C 2: 121,922,687 (GRCm39) T921A probably damaging Het
Tanc2 T A 11: 105,758,400 (GRCm39) D720E possibly damaging Het
Tmprss9 A T 10: 80,730,163 (GRCm39) I688F possibly damaging Het
Trap1 A G 16: 3,862,490 (GRCm39) V596A possibly damaging Het
Ttc32 G T 12: 9,080,187 (GRCm39) R44L probably benign Het
Tusc3 T A 8: 39,597,898 (GRCm39) N288K probably benign Het
Ush2a G A 1: 188,127,956 (GRCm39) G656E probably damaging Het
Vill T C 9: 118,892,671 (GRCm39) probably null Het
Vmn1r5 A T 6: 56,963,182 (GRCm39) R286* probably null Het
Vmn2r14 T C 5: 109,365,533 (GRCm39) T514A probably benign Het
Vmn2r32 G A 7: 7,477,204 (GRCm39) H396Y probably benign Het
Vmn2r75 A T 7: 85,820,765 (GRCm39) Y56* probably null Het
Wdfy3 C T 5: 102,011,983 (GRCm39) S2668N probably benign Het
Wdr72 G A 9: 74,059,729 (GRCm39) D392N probably benign Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141,217,212 (GRCm39) missense unknown
IGL01357:Spen APN 4 141,244,424 (GRCm39) missense unknown
IGL02184:Spen APN 4 141,214,917 (GRCm39) missense unknown
IGL02226:Spen APN 4 141,205,457 (GRCm39) missense unknown
IGL02321:Spen APN 4 141,244,441 (GRCm39) missense unknown
IGL02350:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02357:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02627:Spen APN 4 141,200,326 (GRCm39) missense probably damaging 0.99
IGL02683:Spen APN 4 141,198,956 (GRCm39) missense probably benign 0.06
IGL02945:Spen APN 4 141,221,624 (GRCm39) missense unknown
IGL02950:Spen APN 4 141,196,819 (GRCm39) missense probably damaging 1.00
IGL03008:Spen APN 4 141,203,448 (GRCm39) missense possibly damaging 0.70
IGL03019:Spen APN 4 141,206,227 (GRCm39) missense unknown
IGL03038:Spen APN 4 141,265,550 (GRCm39) missense unknown
IGL03334:Spen APN 4 141,197,280 (GRCm39) missense probably damaging 1.00
filtered UTSW 4 141,204,683 (GRCm39) missense unknown
mentholated UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R0105:Spen UTSW 4 141,197,121 (GRCm39) splice site probably benign
R0268:Spen UTSW 4 141,204,868 (GRCm39) missense unknown
R0359:Spen UTSW 4 141,244,181 (GRCm39) missense unknown
R0394:Spen UTSW 4 141,201,514 (GRCm39) missense probably benign 0.03
R0423:Spen UTSW 4 141,206,647 (GRCm39) missense unknown
R0433:Spen UTSW 4 141,211,069 (GRCm39) missense unknown
R0462:Spen UTSW 4 141,200,962 (GRCm39) missense probably damaging 1.00
R0687:Spen UTSW 4 141,215,339 (GRCm39) missense unknown
R0699:Spen UTSW 4 141,201,702 (GRCm39) missense possibly damaging 0.72
R0865:Spen UTSW 4 141,199,181 (GRCm39) missense probably benign 0.11
R0918:Spen UTSW 4 141,212,875 (GRCm39) missense unknown
R1034:Spen UTSW 4 141,203,063 (GRCm39) missense probably benign 0.33
R1341:Spen UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R1401:Spen UTSW 4 141,199,132 (GRCm39) missense probably damaging 0.98
R1509:Spen UTSW 4 141,202,946 (GRCm39) missense probably benign 0.00
R1509:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R1561:Spen UTSW 4 141,199,694 (GRCm39) nonsense probably null
R1589:Spen UTSW 4 141,215,335 (GRCm39) missense unknown
R1640:Spen UTSW 4 141,196,254 (GRCm39) missense probably damaging 0.98
R1758:Spen UTSW 4 141,203,686 (GRCm39) missense unknown
R1764:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R1824:Spen UTSW 4 141,200,096 (GRCm39) missense probably damaging 1.00
R1899:Spen UTSW 4 141,197,654 (GRCm39) missense probably benign 0.17
R1916:Spen UTSW 4 141,199,909 (GRCm39) missense probably damaging 1.00
R2011:Spen UTSW 4 141,200,640 (GRCm39) missense probably damaging 1.00
R2295:Spen UTSW 4 141,204,584 (GRCm39) missense unknown
R2379:Spen UTSW 4 141,244,238 (GRCm39) missense unknown
R2404:Spen UTSW 4 141,205,216 (GRCm39) missense unknown
R3719:Spen UTSW 4 141,244,494 (GRCm39) missense unknown
R3889:Spen UTSW 4 141,205,192 (GRCm39) missense unknown
R3945:Spen UTSW 4 141,204,664 (GRCm39) missense unknown
R4227:Spen UTSW 4 141,249,458 (GRCm39) missense unknown
R4326:Spen UTSW 4 141,204,683 (GRCm39) missense unknown
R4382:Spen UTSW 4 141,200,450 (GRCm39) missense possibly damaging 0.88
R4542:Spen UTSW 4 141,204,097 (GRCm39) missense unknown
R4757:Spen UTSW 4 141,200,390 (GRCm39) nonsense probably null
R4771:Spen UTSW 4 141,199,907 (GRCm39) missense probably benign 0.14
R5072:Spen UTSW 4 141,249,613 (GRCm39) missense unknown
R5121:Spen UTSW 4 141,203,410 (GRCm39) missense probably benign 0.00
R5176:Spen UTSW 4 141,203,587 (GRCm39) missense unknown
R5290:Spen UTSW 4 141,201,127 (GRCm39) missense probably damaging 1.00
R5291:Spen UTSW 4 141,215,390 (GRCm39) missense unknown
R5293:Spen UTSW 4 141,199,717 (GRCm39) missense possibly damaging 0.89
R5347:Spen UTSW 4 141,198,796 (GRCm39) missense probably benign 0.26
R5511:Spen UTSW 4 141,244,149 (GRCm39) missense unknown
R5511:Spen UTSW 4 141,202,375 (GRCm39) missense possibly damaging 0.86
R5772:Spen UTSW 4 141,205,495 (GRCm39) missense unknown
R5834:Spen UTSW 4 141,199,154 (GRCm39) missense possibly damaging 0.63
R5858:Spen UTSW 4 141,201,182 (GRCm39) missense probably benign 0.05
R6214:Spen UTSW 4 141,206,423 (GRCm39) missense unknown
R6232:Spen UTSW 4 141,244,333 (GRCm39) missense unknown
R6345:Spen UTSW 4 141,198,944 (GRCm39) missense possibly damaging 0.86
R6419:Spen UTSW 4 141,203,621 (GRCm39) missense unknown
R6455:Spen UTSW 4 141,202,820 (GRCm39) missense probably damaging 0.97
R6979:Spen UTSW 4 141,205,374 (GRCm39) missense unknown
R6994:Spen UTSW 4 141,220,770 (GRCm39) missense unknown
R7018:Spen UTSW 4 141,220,755 (GRCm39) missense unknown
R7040:Spen UTSW 4 141,221,693 (GRCm39) missense unknown
R7127:Spen UTSW 4 141,203,419 (GRCm39) missense possibly damaging 0.53
R7218:Spen UTSW 4 141,199,961 (GRCm39) missense possibly damaging 0.54
R7234:Spen UTSW 4 141,206,446 (GRCm39) missense unknown
R7316:Spen UTSW 4 141,204,365 (GRCm39) missense unknown
R7350:Spen UTSW 4 141,206,696 (GRCm39) missense unknown
R7356:Spen UTSW 4 141,199,235 (GRCm39) nonsense probably null
R7400:Spen UTSW 4 141,201,052 (GRCm39) missense probably damaging 1.00
R7470:Spen UTSW 4 141,206,605 (GRCm39) missense unknown
R7698:Spen UTSW 4 141,200,156 (GRCm39) missense probably damaging 1.00
R7858:Spen UTSW 4 141,215,442 (GRCm39) splice site probably null
R8033:Spen UTSW 4 141,199,057 (GRCm39) missense probably benign 0.03
R8064:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R8159:Spen UTSW 4 141,202,314 (GRCm39) missense possibly damaging 0.53
R8187:Spen UTSW 4 141,200,216 (GRCm39) missense possibly damaging 0.93
R8463:Spen UTSW 4 141,249,590 (GRCm39) missense unknown
R8557:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8558:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8672:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8673:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8674:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8714:Spen UTSW 4 141,215,314 (GRCm39) missense unknown
R8735:Spen UTSW 4 141,197,129 (GRCm39) missense probably benign 0.32
R8762:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R8877:Spen UTSW 4 141,199,137 (GRCm39) nonsense probably null
R8878:Spen UTSW 4 141,204,520 (GRCm39) missense unknown
R8937:Spen UTSW 4 141,201,374 (GRCm39) missense probably damaging 1.00
R8939:Spen UTSW 4 141,202,969 (GRCm39) missense possibly damaging 0.72
R8971:Spen UTSW 4 141,201,889 (GRCm39) missense possibly damaging 0.53
R9016:Spen UTSW 4 141,200,938 (GRCm39) missense probably damaging 1.00
R9072:Spen UTSW 4 141,203,702 (GRCm39) missense unknown
R9073:Spen UTSW 4 141,203,702 (GRCm39) missense unknown
R9120:Spen UTSW 4 141,200,233 (GRCm39) missense
R9136:Spen UTSW 4 141,249,623 (GRCm39) missense unknown
R9138:Spen UTSW 4 141,196,797 (GRCm39) missense probably damaging 1.00
R9150:Spen UTSW 4 141,244,468 (GRCm39) missense unknown
R9225:Spen UTSW 4 141,202,943 (GRCm39) missense possibly damaging 0.53
R9492:Spen UTSW 4 141,199,098 (GRCm39) missense probably benign 0.26
R9537:Spen UTSW 4 141,244,156 (GRCm39) small deletion probably benign
R9537:Spen UTSW 4 141,199,015 (GRCm39) missense probably benign 0.15
R9602:Spen UTSW 4 141,205,183 (GRCm39) missense unknown
R9609:Spen UTSW 4 141,215,419 (GRCm39) missense unknown
R9686:Spen UTSW 4 141,199,946 (GRCm39) missense probably benign 0.27
R9697:Spen UTSW 4 141,196,275 (GRCm39) missense probably damaging 1.00
R9713:Spen UTSW 4 141,244,331 (GRCm39) missense unknown
T0722:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
T0975:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
Z1088:Spen UTSW 4 141,205,287 (GRCm39) missense unknown
Z1088:Spen UTSW 4 141,205,288 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GAGAAGACTCTTGTTTGGGAGC -3'
(R):5'- GCTGCCAATTCTGACTGTCC -3'

Sequencing Primer
(F):5'- TGGACTTCAGCGTGAGGC -3'
(R):5'- TTGCAGTCCACGCAGTCTG -3'
Posted On 2021-10-11