Incidental Mutation 'R8968:Cep135'
ID 682840
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Name centrosomal protein 135
Synonyms Cep4, LOC381644
MMRRC Submission 068802-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8968 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 76736545-76794313 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76754576 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 351 (I351T)
Ref Sequence ENSEMBL: ENSMUSP00000038674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
AlphaFold Q6P5D4
Predicted Effect possibly damaging
Transcript: ENSMUST00000049060
AA Change: I351T

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: I351T

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121979
AA Change: I351T

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: I351T

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,480,429 (GRCm39) L1153* probably null Het
Adamts2 T C 11: 50,683,550 (GRCm39) I944T possibly damaging Het
Aqp9 A T 9: 71,045,485 (GRCm39) C67* probably null Het
Armt1 G T 10: 4,404,150 (GRCm39) G412W probably damaging Het
B4galt1 T C 4: 40,807,243 (GRCm39) D381G probably benign Het
Bmp5 A T 9: 75,780,579 (GRCm39) H292L probably benign Het
Brpf1 T C 6: 113,299,510 (GRCm39) F1181S probably damaging Het
Btbd7 C A 12: 102,779,025 (GRCm39) G414C probably damaging Het
Ccdc65 A T 15: 98,616,723 (GRCm39) K204* probably null Het
Cdk5 T A 5: 24,627,379 (GRCm39) K88M probably damaging Het
Cdrt4 T A 11: 62,883,634 (GRCm39) L112Q probably damaging Het
Cenpb T C 2: 131,020,547 (GRCm39) E417G unknown Het
Ces1d A T 8: 93,914,383 (GRCm39) S226R probably damaging Het
Cfap97 T A 8: 46,623,114 (GRCm39) V168E possibly damaging Het
CN725425 T C 15: 91,130,090 (GRCm39) C318R possibly damaging Het
Cnga3 T A 1: 37,300,460 (GRCm39) D393E probably benign Het
Cplane1 A T 15: 8,230,765 (GRCm39) H1014L possibly damaging Het
Cpsf1 G A 15: 76,486,169 (GRCm39) R358* probably null Het
Cyp2b23 G A 7: 26,378,963 (GRCm39) P167L probably damaging Het
Cyp2c70 A T 19: 40,142,059 (GRCm39) H477Q probably benign Het
D930020B18Rik A C 10: 121,490,721 (GRCm39) Y107S probably damaging Het
Dhrs1 A T 14: 55,978,192 (GRCm39) F216I probably benign Het
Dmgdh A T 13: 93,845,767 (GRCm39) K474* probably null Het
Dsp T C 13: 38,335,596 (GRCm39) I11T possibly damaging Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,077,444 (GRCm39) probably benign Het
Grid2 A C 6: 64,643,139 (GRCm39) H967P probably benign Het
Hc A G 2: 34,922,317 (GRCm39) I503T possibly damaging Het
Herc3 T C 6: 58,867,183 (GRCm39) L824S probably damaging Het
Hfm1 T C 5: 107,065,439 (GRCm39) D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspa1l A G 17: 35,196,230 (GRCm39) K90E possibly damaging Het
Impa2 G A 18: 67,451,497 (GRCm39) V264I probably benign Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Klhl38 C T 15: 58,185,500 (GRCm39) V410I probably benign Het
Lcn4 A G 2: 26,558,360 (GRCm39) I175T possibly damaging Het
Lipo2 C A 19: 33,726,917 (GRCm39) W40L probably damaging Het
Mgam A T 6: 40,734,745 (GRCm39) probably null Het
Myo16 T A 8: 10,619,700 (GRCm39) I1417N unknown Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4a66 T A 2: 88,531,137 (GRCm39) I179F probably benign Het
Or52e19b A T 7: 103,032,667 (GRCm39) C181S probably damaging Het
Or5j3 G A 2: 86,128,526 (GRCm39) R122H probably benign Het
Pcdha11 A G 18: 37,145,307 (GRCm39) N466S probably damaging Het
Pif1 C T 9: 65,499,076 (GRCm39) T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 110,350,420 (GRCm39) probably benign Het
Pole T C 5: 110,459,949 (GRCm39) S1118P possibly damaging Het
Ppp4r4 T C 12: 103,566,706 (GRCm39) M652T probably benign Het
Prex2 A T 1: 11,180,562 (GRCm39) K376* probably null Het
Prps1l1 A T 12: 35,035,205 (GRCm39) I107F probably damaging Het
Resf1 T A 6: 149,228,664 (GRCm39) V570D probably damaging Het
Rfc1 C T 5: 65,432,778 (GRCm39) V761I probably benign Het
Ripk4 T C 16: 97,547,203 (GRCm39) E353G probably benign Het
Robo2 C A 16: 73,767,941 (GRCm39) probably null Het
Rrm1 C T 7: 102,117,545 (GRCm39) A745V probably benign Het
Sash1 A T 10: 8,606,179 (GRCm39) V737D probably benign Het
Sel1l2 T C 2: 140,127,209 (GRCm39) K101E probably benign Het
Selenbp2 A T 3: 94,607,337 (GRCm39) I253F probably benign Het
Setd1a C T 7: 127,385,279 (GRCm39) P662L possibly damaging Het
Slc16a6 C T 11: 109,345,776 (GRCm39) V496I possibly damaging Het
Slc4a4 A T 5: 89,232,512 (GRCm39) M239L probably benign Het
Slc7a8 G C 14: 55,018,750 (GRCm39) A12G probably benign Het
Snx30 T C 4: 59,886,517 (GRCm39) S309P possibly damaging Het
Spen T C 4: 141,197,701 (GRCm39) N3389S probably benign Het
Spg11 T C 2: 121,922,687 (GRCm39) T921A probably damaging Het
Tanc2 T A 11: 105,758,400 (GRCm39) D720E possibly damaging Het
Tmprss9 A T 10: 80,730,163 (GRCm39) I688F possibly damaging Het
Trap1 A G 16: 3,862,490 (GRCm39) V596A possibly damaging Het
Ttc32 G T 12: 9,080,187 (GRCm39) R44L probably benign Het
Tusc3 T A 8: 39,597,898 (GRCm39) N288K probably benign Het
Ush2a G A 1: 188,127,956 (GRCm39) G656E probably damaging Het
Vill T C 9: 118,892,671 (GRCm39) probably null Het
Vmn1r5 A T 6: 56,963,182 (GRCm39) R286* probably null Het
Vmn2r14 T C 5: 109,365,533 (GRCm39) T514A probably benign Het
Vmn2r32 G A 7: 7,477,204 (GRCm39) H396Y probably benign Het
Vmn2r75 A T 7: 85,820,765 (GRCm39) Y56* probably null Het
Wdfy3 C T 5: 102,011,983 (GRCm39) S2668N probably benign Het
Wdr72 G A 9: 74,059,729 (GRCm39) D392N probably benign Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76,749,306 (GRCm39) missense probably damaging 0.98
IGL01154:Cep135 APN 5 76,754,643 (GRCm39) splice site probably benign
IGL01323:Cep135 APN 5 76,739,612 (GRCm39) missense probably benign 0.29
IGL01599:Cep135 APN 5 76,741,194 (GRCm39) missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76,788,829 (GRCm39) makesense probably null
IGL02178:Cep135 APN 5 76,743,321 (GRCm39) missense probably damaging 1.00
IGL02276:Cep135 APN 5 76,782,093 (GRCm39) missense probably benign 0.00
IGL02344:Cep135 APN 5 76,764,668 (GRCm39) missense probably benign
IGL02394:Cep135 APN 5 76,779,318 (GRCm39) missense probably benign 0.02
IGL02740:Cep135 APN 5 76,786,115 (GRCm39) critical splice donor site probably null
IGL02832:Cep135 APN 5 76,788,796 (GRCm39) missense probably damaging 0.98
R0026:Cep135 UTSW 5 76,754,581 (GRCm39) nonsense probably null
R0060:Cep135 UTSW 5 76,769,197 (GRCm39) missense probably benign 0.20
R0325:Cep135 UTSW 5 76,763,590 (GRCm39) missense probably damaging 0.98
R0336:Cep135 UTSW 5 76,749,349 (GRCm39) missense probably benign 0.07
R0564:Cep135 UTSW 5 76,786,796 (GRCm39) missense probably benign 0.03
R0564:Cep135 UTSW 5 76,763,557 (GRCm39) missense probably damaging 1.00
R0600:Cep135 UTSW 5 76,769,152 (GRCm39) missense probably benign
R0636:Cep135 UTSW 5 76,763,504 (GRCm39) missense probably benign 0.07
R0704:Cep135 UTSW 5 76,778,796 (GRCm39) missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76,763,553 (GRCm39) missense probably benign 0.40
R1015:Cep135 UTSW 5 76,788,844 (GRCm39) critical splice donor site probably null
R1167:Cep135 UTSW 5 76,772,484 (GRCm39) missense probably damaging 1.00
R1252:Cep135 UTSW 5 76,741,962 (GRCm39) missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76,782,060 (GRCm39) nonsense probably null
R1770:Cep135 UTSW 5 76,751,042 (GRCm39) missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76,784,779 (GRCm39) missense probably benign 0.22
R1968:Cep135 UTSW 5 76,772,594 (GRCm39) missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76,745,275 (GRCm39) missense probably benign 0.00
R1996:Cep135 UTSW 5 76,780,113 (GRCm39) missense probably benign 0.08
R2004:Cep135 UTSW 5 76,780,176 (GRCm39) critical splice donor site probably null
R2178:Cep135 UTSW 5 76,779,297 (GRCm39) missense probably benign 0.00
R2305:Cep135 UTSW 5 76,743,236 (GRCm39) splice site probably benign
R2679:Cep135 UTSW 5 76,772,507 (GRCm39) missense probably benign
R3125:Cep135 UTSW 5 76,769,210 (GRCm39) critical splice donor site probably null
R3623:Cep135 UTSW 5 76,772,586 (GRCm39) missense probably benign 0.00
R4359:Cep135 UTSW 5 76,759,561 (GRCm39) missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76,772,514 (GRCm39) missense probably benign
R4561:Cep135 UTSW 5 76,786,040 (GRCm39) missense possibly damaging 0.95
R4666:Cep135 UTSW 5 76,764,701 (GRCm39) missense probably benign
R4945:Cep135 UTSW 5 76,745,275 (GRCm39) missense probably benign 0.00
R5105:Cep135 UTSW 5 76,741,939 (GRCm39) missense probably benign 0.00
R5117:Cep135 UTSW 5 76,779,276 (GRCm39) missense probably benign 0.01
R5176:Cep135 UTSW 5 76,784,873 (GRCm39) missense probably benign 0.04
R5194:Cep135 UTSW 5 76,763,624 (GRCm39) missense probably benign 0.05
R5233:Cep135 UTSW 5 76,739,690 (GRCm39) small deletion probably benign
R5275:Cep135 UTSW 5 76,741,051 (GRCm39) missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76,741,051 (GRCm39) missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76,764,709 (GRCm39) missense probably benign 0.00
R5427:Cep135 UTSW 5 76,786,049 (GRCm39) missense probably benign 0.00
R5801:Cep135 UTSW 5 76,778,523 (GRCm39) missense probably damaging 1.00
R5975:Cep135 UTSW 5 76,788,737 (GRCm39) missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76,763,638 (GRCm39) critical splice donor site probably null
R6176:Cep135 UTSW 5 76,772,490 (GRCm39) missense probably benign
R6210:Cep135 UTSW 5 76,772,570 (GRCm39) missense probably benign 0.15
R6456:Cep135 UTSW 5 76,739,571 (GRCm39) start gained probably benign
R6467:Cep135 UTSW 5 76,769,187 (GRCm39) missense possibly damaging 0.50
R6622:Cep135 UTSW 5 76,788,815 (GRCm39) missense probably benign 0.00
R6650:Cep135 UTSW 5 76,781,548 (GRCm39) missense possibly damaging 0.77
R6838:Cep135 UTSW 5 76,780,062 (GRCm39) missense probably damaging 1.00
R7028:Cep135 UTSW 5 76,764,695 (GRCm39) missense probably benign
R7049:Cep135 UTSW 5 76,754,585 (GRCm39) missense probably benign 0.01
R7095:Cep135 UTSW 5 76,741,905 (GRCm39) missense probably benign 0.10
R7207:Cep135 UTSW 5 76,780,090 (GRCm39) missense probably benign 0.00
R7330:Cep135 UTSW 5 76,754,592 (GRCm39) nonsense probably null
R7369:Cep135 UTSW 5 76,741,100 (GRCm39) missense possibly damaging 0.94
R7741:Cep135 UTSW 5 76,778,817 (GRCm39) missense probably damaging 0.99
R7850:Cep135 UTSW 5 76,739,720 (GRCm39) critical splice donor site probably null
R7869:Cep135 UTSW 5 76,788,803 (GRCm39) missense probably benign 0.00
R7923:Cep135 UTSW 5 76,757,539 (GRCm39) missense possibly damaging 0.90
R8303:Cep135 UTSW 5 76,759,575 (GRCm39) missense probably damaging 1.00
R8312:Cep135 UTSW 5 76,784,746 (GRCm39) missense probably damaging 1.00
R8424:Cep135 UTSW 5 76,741,906 (GRCm39) missense possibly damaging 0.64
R8490:Cep135 UTSW 5 76,786,054 (GRCm39) missense probably benign 0.00
R8967:Cep135 UTSW 5 76,751,165 (GRCm39) missense probably damaging 1.00
R9126:Cep135 UTSW 5 76,781,550 (GRCm39) missense probably benign 0.08
R9726:Cep135 UTSW 5 76,741,151 (GRCm39) missense probably benign
Z1177:Cep135 UTSW 5 76,739,673 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACACTGCAGTATTAAACAGATGC -3'
(R):5'- GCAAAATCACACTGTGGACC -3'

Sequencing Primer
(F):5'- AAACAGATGCTTCATCTCGTTTTGC -3'
(R):5'- GGATGCAGGATTCATCATTCACC -3'
Posted On 2021-10-11