Incidental Mutation 'R8968:Herc3'
ID 682848
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Name hect domain and RLD 3
Synonyms 5730409F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8968 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 58831465-58920398 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58890198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 824 (L824S)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000204629]
AlphaFold A6H6S0
Predicted Effect probably damaging
Transcript: ENSMUST00000031823
AA Change: L824S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: L824S

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041401
AA Change: L824S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: L824S

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204629
AA Change: L35S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145319
Gene: ENSMUSG00000029804
AA Change: L35S

DomainStartEndE-ValueType
Pfam:HECT 1 97 1.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,332,310 L1153* probably null Het
2410089E03Rik A T 15: 8,201,281 H1014L possibly damaging Het
2810474O19Rik T A 6: 149,327,166 V570D probably damaging Het
Adamts2 T C 11: 50,792,723 I944T possibly damaging Het
Aqp9 A T 9: 71,138,203 C67* probably null Het
Armt1 G T 10: 4,454,150 G412W probably damaging Het
B4galt1 T C 4: 40,807,243 D381G probably benign Het
Bmp5 A T 9: 75,873,297 H292L probably benign Het
Brpf1 T C 6: 113,322,549 F1181S probably damaging Het
Btbd7 C A 12: 102,812,766 G414C probably damaging Het
Ccdc65 A T 15: 98,718,842 K204* probably null Het
Cdk5 T A 5: 24,422,381 K88M probably damaging Het
Cdrt4 T A 11: 62,992,808 L112Q probably damaging Het
Cenpb T C 2: 131,178,627 E417G unknown Het
Cep135 T C 5: 76,606,729 I351T possibly damaging Het
Ces1d A T 8: 93,187,755 S226R probably damaging Het
Cfap97 T A 8: 46,170,077 V168E possibly damaging Het
CN725425 T C 15: 91,245,887 C318R possibly damaging Het
Cnga3 T A 1: 37,261,379 D393E probably benign Het
Cpsf1 G A 15: 76,601,969 R358* probably null Het
Cyp2b23 G A 7: 26,679,538 P167L probably damaging Het
Cyp2c70 A T 19: 40,153,615 H477Q probably benign Het
D930020B18Rik A C 10: 121,654,816 Y107S probably damaging Het
Dhrs1 A T 14: 55,740,735 F216I probably benign Het
Dmgdh A T 13: 93,709,259 K474* probably null Het
Dsp T C 13: 38,151,620 I11T possibly damaging Het
Erh G T 12: 80,637,508 A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,186,618 probably benign Het
Grid2 A C 6: 64,666,155 H967P probably benign Het
Hc A G 2: 35,032,305 I503T possibly damaging Het
Hfm1 T C 5: 106,917,573 D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hspa1l A G 17: 34,977,254 K90E possibly damaging Het
Impa2 G A 18: 67,318,427 V264I probably benign Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Klhl38 C T 15: 58,322,104 V410I probably benign Het
Lcn4 A G 2: 26,668,348 I175T possibly damaging Het
Lipo2 C A 19: 33,749,517 W40L probably damaging Het
Mgam A T 6: 40,757,811 probably null Het
Myo16 T A 8: 10,569,700 I1417N unknown Het
Olfr1052 G A 2: 86,298,182 R122H probably benign Het
Olfr1196 T A 2: 88,700,793 I179F probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr603 A T 7: 103,383,460 C181S probably damaging Het
Pcdha11 A G 18: 37,012,254 N466S probably damaging Het
Pif1 C T 9: 65,591,794 T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Pole T C 5: 110,312,083 S1118P possibly damaging Het
Ppp4r4 T C 12: 103,600,447 M652T probably benign Het
Prex2 A T 1: 11,110,338 K376* probably null Het
Prps1l1 A T 12: 34,985,206 I107F probably damaging Het
Rfc1 C T 5: 65,275,435 V761I probably benign Het
Ripk4 T C 16: 97,746,003 E353G probably benign Het
Robo2 C A 16: 73,971,053 probably null Het
Rrm1 C T 7: 102,468,338 A745V probably benign Het
Sash1 A T 10: 8,730,415 V737D probably benign Het
Sel1l2 T C 2: 140,285,289 K101E probably benign Het
Selenbp2 A T 3: 94,700,030 I253F probably benign Het
Setd1a C T 7: 127,786,107 P662L possibly damaging Het
Slc16a6 C T 11: 109,454,950 V496I possibly damaging Het
Slc4a4 A T 5: 89,084,653 M239L probably benign Het
Slc7a8 G C 14: 54,781,293 A12G probably benign Het
Snx30 T C 4: 59,886,517 S309P possibly damaging Het
Spen T C 4: 141,470,390 N3389S probably benign Het
Spg11 T C 2: 122,092,206 T921A probably damaging Het
Tanc2 T A 11: 105,867,574 D720E possibly damaging Het
Tmprss9 A T 10: 80,894,329 I688F possibly damaging Het
Trap1 A G 16: 4,044,626 V596A possibly damaging Het
Ttc32 G T 12: 9,030,187 R44L probably benign Het
Tusc3 T A 8: 39,130,744 N288K probably benign Het
Ush2a G A 1: 188,395,759 G656E probably damaging Het
Vill T C 9: 119,063,603 probably null Het
Vmn1r5 A T 6: 56,986,197 R286* probably null Het
Vmn2r14 T C 5: 109,217,667 T514A probably benign Het
Vmn2r32 G A 7: 7,474,205 H396Y probably benign Het
Vmn2r75 A T 7: 86,171,557 Y56* probably null Het
Wdfy3 C T 5: 101,864,117 S2668N probably benign Het
Wdr72 G A 9: 74,152,447 D392N probably benign Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58874263 missense probably damaging 1.00
IGL00423:Herc3 APN 6 58868715 missense probably damaging 0.99
IGL00468:Herc3 APN 6 58918766 missense probably benign 0.04
IGL01153:Herc3 APN 6 58860336 missense probably benign 0.21
IGL01468:Herc3 APN 6 58854895 missense probably benign 0.00
IGL01696:Herc3 APN 6 58860386 missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58916576 missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58868694 missense probably benign
IGL02953:Herc3 APN 6 58857733 nonsense probably null
aegean UTSW 6 58855760 nonsense probably null
PIT4519001:Herc3 UTSW 6 58876811 missense probably damaging 1.00
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0268:Herc3 UTSW 6 58868628 splice site probably benign
R0334:Herc3 UTSW 6 58918817 missense probably damaging 1.00
R0344:Herc3 UTSW 6 58868628 splice site probably benign
R0853:Herc3 UTSW 6 58876564 missense probably damaging 1.00
R0927:Herc3 UTSW 6 58868763 missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58887493 missense probably damaging 1.00
R1432:Herc3 UTSW 6 58916842 missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58876515 nonsense probably null
R1594:Herc3 UTSW 6 58887584 unclassified probably benign
R1757:Herc3 UTSW 6 58916470 missense probably damaging 1.00
R1765:Herc3 UTSW 6 58888660 missense probably damaging 0.99
R1932:Herc3 UTSW 6 58876793 missense probably damaging 0.99
R1945:Herc3 UTSW 6 58887439 missense probably damaging 0.96
R1988:Herc3 UTSW 6 58884975 critical splice donor site probably null
R2172:Herc3 UTSW 6 58887437 missense probably damaging 1.00
R3080:Herc3 UTSW 6 58856646 splice site probably null
R3545:Herc3 UTSW 6 58856685 missense probably damaging 1.00
R3767:Herc3 UTSW 6 58862988 missense probably benign
R3767:Herc3 UTSW 6 58876602 missense probably benign 0.00
R3805:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R3806:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R4049:Herc3 UTSW 6 58876837 missense probably damaging 0.99
R4250:Herc3 UTSW 6 58916516 missense probably damaging 1.00
R4469:Herc3 UTSW 6 58876809 nonsense probably null
R4534:Herc3 UTSW 6 58860347 missense probably benign
R4573:Herc3 UTSW 6 58894113 missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58887499 missense probably damaging 1.00
R5047:Herc3 UTSW 6 58855760 nonsense probably null
R5049:Herc3 UTSW 6 58894539 splice site probably null
R5062:Herc3 UTSW 6 58855760 nonsense probably null
R5063:Herc3 UTSW 6 58855760 nonsense probably null
R5288:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5297:Herc3 UTSW 6 58856641 missense probably damaging 1.00
R5386:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5435:Herc3 UTSW 6 58855806 missense probably damaging 1.00
R5576:Herc3 UTSW 6 58888725 missense probably benign 0.08
R5605:Herc3 UTSW 6 58857727 missense probably damaging 1.00
R5719:Herc3 UTSW 6 58894543 missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58918799 missense probably benign 0.12
R5870:Herc3 UTSW 6 58916450 missense probably benign 0.01
R6460:Herc3 UTSW 6 58890123 missense probably damaging 1.00
R6930:Herc3 UTSW 6 58916459 missense probably damaging 0.98
R7034:Herc3 UTSW 6 58876855 missense probably benign 0.00
R7131:Herc3 UTSW 6 58887424 missense probably damaging 1.00
R7187:Herc3 UTSW 6 58856631 missense probably benign 0.42
R7212:Herc3 UTSW 6 58918773 missense probably damaging 1.00
R7335:Herc3 UTSW 6 58876788 missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58858986 missense probably benign
R7568:Herc3 UTSW 6 58843810 missense probably benign 0.01
R7857:Herc3 UTSW 6 58843652 nonsense probably null
R8321:Herc3 UTSW 6 58843769 missense possibly damaging 0.93
R8672:Herc3 UTSW 6 58873801 missense probably damaging 0.96
R8684:Herc3 UTSW 6 58887576 missense probably damaging 1.00
R8994:Herc3 UTSW 6 58874343 missense probably benign 0.11
R9219:Herc3 UTSW 6 58894567 missense probably benign 0.01
R9434:Herc3 UTSW 6 58876861 missense probably benign 0.00
R9562:Herc3 UTSW 6 58859014 missense probably null 0.01
R9565:Herc3 UTSW 6 58859014 missense probably null 0.01
Z1176:Herc3 UTSW 6 58843858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGGCCAGGGAGGTTTCTC -3'
(R):5'- AGGCAACGCTTTACACAATGC -3'

Sequencing Primer
(F):5'- GCTTCAGTATAAATGTAAACAGGGC -3'
(R):5'- ACAATGCTGTGTGATCTACAGG -3'
Posted On 2021-10-11