Incidental Mutation 'R8968:Herc3'
ID 682848
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Name hect domain and RLD 3
Synonyms 5730409F18Rik
MMRRC Submission 068802-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8968 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 58808450-58897383 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58867183 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 824 (L824S)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000204629]
AlphaFold A6H6S0
Predicted Effect probably damaging
Transcript: ENSMUST00000031823
AA Change: L824S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: L824S

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041401
AA Change: L824S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: L824S

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204629
AA Change: L35S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145319
Gene: ENSMUSG00000029804
AA Change: L35S

DomainStartEndE-ValueType
Pfam:HECT 1 97 1.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,480,429 (GRCm39) L1153* probably null Het
Adamts2 T C 11: 50,683,550 (GRCm39) I944T possibly damaging Het
Aqp9 A T 9: 71,045,485 (GRCm39) C67* probably null Het
Armt1 G T 10: 4,404,150 (GRCm39) G412W probably damaging Het
B4galt1 T C 4: 40,807,243 (GRCm39) D381G probably benign Het
Bmp5 A T 9: 75,780,579 (GRCm39) H292L probably benign Het
Brpf1 T C 6: 113,299,510 (GRCm39) F1181S probably damaging Het
Btbd7 C A 12: 102,779,025 (GRCm39) G414C probably damaging Het
Ccdc65 A T 15: 98,616,723 (GRCm39) K204* probably null Het
Cdk5 T A 5: 24,627,379 (GRCm39) K88M probably damaging Het
Cdrt4 T A 11: 62,883,634 (GRCm39) L112Q probably damaging Het
Cenpb T C 2: 131,020,547 (GRCm39) E417G unknown Het
Cep135 T C 5: 76,754,576 (GRCm39) I351T possibly damaging Het
Ces1d A T 8: 93,914,383 (GRCm39) S226R probably damaging Het
Cfap97 T A 8: 46,623,114 (GRCm39) V168E possibly damaging Het
CN725425 T C 15: 91,130,090 (GRCm39) C318R possibly damaging Het
Cnga3 T A 1: 37,300,460 (GRCm39) D393E probably benign Het
Cplane1 A T 15: 8,230,765 (GRCm39) H1014L possibly damaging Het
Cpsf1 G A 15: 76,486,169 (GRCm39) R358* probably null Het
Cyp2b23 G A 7: 26,378,963 (GRCm39) P167L probably damaging Het
Cyp2c70 A T 19: 40,142,059 (GRCm39) H477Q probably benign Het
D930020B18Rik A C 10: 121,490,721 (GRCm39) Y107S probably damaging Het
Dhrs1 A T 14: 55,978,192 (GRCm39) F216I probably benign Het
Dmgdh A T 13: 93,845,767 (GRCm39) K474* probably null Het
Dsp T C 13: 38,335,596 (GRCm39) I11T possibly damaging Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,077,444 (GRCm39) probably benign Het
Grid2 A C 6: 64,643,139 (GRCm39) H967P probably benign Het
Hc A G 2: 34,922,317 (GRCm39) I503T possibly damaging Het
Hfm1 T C 5: 107,065,439 (GRCm39) D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspa1l A G 17: 35,196,230 (GRCm39) K90E possibly damaging Het
Impa2 G A 18: 67,451,497 (GRCm39) V264I probably benign Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Klhl38 C T 15: 58,185,500 (GRCm39) V410I probably benign Het
Lcn4 A G 2: 26,558,360 (GRCm39) I175T possibly damaging Het
Lipo2 C A 19: 33,726,917 (GRCm39) W40L probably damaging Het
Mgam A T 6: 40,734,745 (GRCm39) probably null Het
Myo16 T A 8: 10,619,700 (GRCm39) I1417N unknown Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4a66 T A 2: 88,531,137 (GRCm39) I179F probably benign Het
Or52e19b A T 7: 103,032,667 (GRCm39) C181S probably damaging Het
Or5j3 G A 2: 86,128,526 (GRCm39) R122H probably benign Het
Pcdha11 A G 18: 37,145,307 (GRCm39) N466S probably damaging Het
Pif1 C T 9: 65,499,076 (GRCm39) T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 110,350,420 (GRCm39) probably benign Het
Pole T C 5: 110,459,949 (GRCm39) S1118P possibly damaging Het
Ppp4r4 T C 12: 103,566,706 (GRCm39) M652T probably benign Het
Prex2 A T 1: 11,180,562 (GRCm39) K376* probably null Het
Prps1l1 A T 12: 35,035,205 (GRCm39) I107F probably damaging Het
Resf1 T A 6: 149,228,664 (GRCm39) V570D probably damaging Het
Rfc1 C T 5: 65,432,778 (GRCm39) V761I probably benign Het
Ripk4 T C 16: 97,547,203 (GRCm39) E353G probably benign Het
Robo2 C A 16: 73,767,941 (GRCm39) probably null Het
Rrm1 C T 7: 102,117,545 (GRCm39) A745V probably benign Het
Sash1 A T 10: 8,606,179 (GRCm39) V737D probably benign Het
Sel1l2 T C 2: 140,127,209 (GRCm39) K101E probably benign Het
Selenbp2 A T 3: 94,607,337 (GRCm39) I253F probably benign Het
Setd1a C T 7: 127,385,279 (GRCm39) P662L possibly damaging Het
Slc16a6 C T 11: 109,345,776 (GRCm39) V496I possibly damaging Het
Slc4a4 A T 5: 89,232,512 (GRCm39) M239L probably benign Het
Slc7a8 G C 14: 55,018,750 (GRCm39) A12G probably benign Het
Snx30 T C 4: 59,886,517 (GRCm39) S309P possibly damaging Het
Spen T C 4: 141,197,701 (GRCm39) N3389S probably benign Het
Spg11 T C 2: 121,922,687 (GRCm39) T921A probably damaging Het
Tanc2 T A 11: 105,758,400 (GRCm39) D720E possibly damaging Het
Tmprss9 A T 10: 80,730,163 (GRCm39) I688F possibly damaging Het
Trap1 A G 16: 3,862,490 (GRCm39) V596A possibly damaging Het
Ttc32 G T 12: 9,080,187 (GRCm39) R44L probably benign Het
Tusc3 T A 8: 39,597,898 (GRCm39) N288K probably benign Het
Ush2a G A 1: 188,127,956 (GRCm39) G656E probably damaging Het
Vill T C 9: 118,892,671 (GRCm39) probably null Het
Vmn1r5 A T 6: 56,963,182 (GRCm39) R286* probably null Het
Vmn2r14 T C 5: 109,365,533 (GRCm39) T514A probably benign Het
Vmn2r32 G A 7: 7,477,204 (GRCm39) H396Y probably benign Het
Vmn2r75 A T 7: 85,820,765 (GRCm39) Y56* probably null Het
Wdfy3 C T 5: 102,011,983 (GRCm39) S2668N probably benign Het
Wdr72 G A 9: 74,059,729 (GRCm39) D392N probably benign Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58,851,248 (GRCm39) missense probably damaging 1.00
IGL00423:Herc3 APN 6 58,845,700 (GRCm39) missense probably damaging 0.99
IGL00468:Herc3 APN 6 58,895,751 (GRCm39) missense probably benign 0.04
IGL01153:Herc3 APN 6 58,837,321 (GRCm39) missense probably benign 0.21
IGL01468:Herc3 APN 6 58,831,880 (GRCm39) missense probably benign 0.00
IGL01696:Herc3 APN 6 58,837,371 (GRCm39) missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58,893,561 (GRCm39) missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58,845,679 (GRCm39) missense probably benign
IGL02953:Herc3 APN 6 58,834,718 (GRCm39) nonsense probably null
aegean UTSW 6 58,832,745 (GRCm39) nonsense probably null
PIT4519001:Herc3 UTSW 6 58,853,796 (GRCm39) missense probably damaging 1.00
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0268:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0334:Herc3 UTSW 6 58,895,802 (GRCm39) missense probably damaging 1.00
R0344:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0853:Herc3 UTSW 6 58,853,549 (GRCm39) missense probably damaging 1.00
R0927:Herc3 UTSW 6 58,845,748 (GRCm39) missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58,864,478 (GRCm39) missense probably damaging 1.00
R1432:Herc3 UTSW 6 58,893,827 (GRCm39) missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58,853,500 (GRCm39) nonsense probably null
R1594:Herc3 UTSW 6 58,864,569 (GRCm39) unclassified probably benign
R1757:Herc3 UTSW 6 58,893,455 (GRCm39) missense probably damaging 1.00
R1765:Herc3 UTSW 6 58,865,645 (GRCm39) missense probably damaging 0.99
R1932:Herc3 UTSW 6 58,853,778 (GRCm39) missense probably damaging 0.99
R1945:Herc3 UTSW 6 58,864,424 (GRCm39) missense probably damaging 0.96
R1988:Herc3 UTSW 6 58,861,960 (GRCm39) critical splice donor site probably null
R2172:Herc3 UTSW 6 58,864,422 (GRCm39) missense probably damaging 1.00
R3080:Herc3 UTSW 6 58,833,631 (GRCm39) splice site probably null
R3545:Herc3 UTSW 6 58,833,670 (GRCm39) missense probably damaging 1.00
R3767:Herc3 UTSW 6 58,853,587 (GRCm39) missense probably benign 0.00
R3767:Herc3 UTSW 6 58,839,973 (GRCm39) missense probably benign
R3805:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R3806:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R4049:Herc3 UTSW 6 58,853,822 (GRCm39) missense probably damaging 0.99
R4250:Herc3 UTSW 6 58,893,501 (GRCm39) missense probably damaging 1.00
R4469:Herc3 UTSW 6 58,853,794 (GRCm39) nonsense probably null
R4534:Herc3 UTSW 6 58,837,332 (GRCm39) missense probably benign
R4573:Herc3 UTSW 6 58,871,098 (GRCm39) missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58,864,484 (GRCm39) missense probably damaging 1.00
R5047:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5049:Herc3 UTSW 6 58,871,524 (GRCm39) splice site probably null
R5062:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5063:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5288:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5297:Herc3 UTSW 6 58,833,626 (GRCm39) missense probably damaging 1.00
R5386:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5435:Herc3 UTSW 6 58,832,791 (GRCm39) missense probably damaging 1.00
R5576:Herc3 UTSW 6 58,865,710 (GRCm39) missense probably benign 0.08
R5605:Herc3 UTSW 6 58,834,712 (GRCm39) missense probably damaging 1.00
R5719:Herc3 UTSW 6 58,871,528 (GRCm39) missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58,895,784 (GRCm39) missense probably benign 0.12
R5870:Herc3 UTSW 6 58,893,435 (GRCm39) missense probably benign 0.01
R6460:Herc3 UTSW 6 58,867,108 (GRCm39) missense probably damaging 1.00
R6930:Herc3 UTSW 6 58,893,444 (GRCm39) missense probably damaging 0.98
R7034:Herc3 UTSW 6 58,853,840 (GRCm39) missense probably benign 0.00
R7131:Herc3 UTSW 6 58,864,409 (GRCm39) missense probably damaging 1.00
R7187:Herc3 UTSW 6 58,833,616 (GRCm39) missense probably benign 0.42
R7212:Herc3 UTSW 6 58,895,758 (GRCm39) missense probably damaging 1.00
R7335:Herc3 UTSW 6 58,853,773 (GRCm39) missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58,835,971 (GRCm39) missense probably benign
R7568:Herc3 UTSW 6 58,820,795 (GRCm39) missense probably benign 0.01
R7857:Herc3 UTSW 6 58,820,637 (GRCm39) nonsense probably null
R8321:Herc3 UTSW 6 58,820,754 (GRCm39) missense possibly damaging 0.93
R8672:Herc3 UTSW 6 58,850,786 (GRCm39) missense probably damaging 0.96
R8684:Herc3 UTSW 6 58,864,561 (GRCm39) missense probably damaging 1.00
R8994:Herc3 UTSW 6 58,851,328 (GRCm39) missense probably benign 0.11
R9219:Herc3 UTSW 6 58,871,552 (GRCm39) missense probably benign 0.01
R9434:Herc3 UTSW 6 58,853,846 (GRCm39) missense probably benign 0.00
R9562:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
R9565:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
Z1176:Herc3 UTSW 6 58,820,843 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGGCCAGGGAGGTTTCTC -3'
(R):5'- AGGCAACGCTTTACACAATGC -3'

Sequencing Primer
(F):5'- GCTTCAGTATAAATGTAAACAGGGC -3'
(R):5'- ACAATGCTGTGTGATCTACAGG -3'
Posted On 2021-10-11