Incidental Mutation 'R8968:Myo16'
ID 682858
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Name myosin XVI
Synonyms C230040D10Rik, BM140241, Nyap3
MMRRC Submission 068802-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.325) question?
Stock # R8968 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 10203911-10684742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10619700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1417 (I1417N)
Ref Sequence ENSEMBL: ENSMUSP00000146677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477]
AlphaFold Q5DU14
Predicted Effect probably damaging
Transcript: ENSMUST00000042103
AA Change: I1417N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: I1417N

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207204
AA Change: I1361N
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: I1417N
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,480,429 (GRCm39) L1153* probably null Het
Adamts2 T C 11: 50,683,550 (GRCm39) I944T possibly damaging Het
Aqp9 A T 9: 71,045,485 (GRCm39) C67* probably null Het
Armt1 G T 10: 4,404,150 (GRCm39) G412W probably damaging Het
B4galt1 T C 4: 40,807,243 (GRCm39) D381G probably benign Het
Bmp5 A T 9: 75,780,579 (GRCm39) H292L probably benign Het
Brpf1 T C 6: 113,299,510 (GRCm39) F1181S probably damaging Het
Btbd7 C A 12: 102,779,025 (GRCm39) G414C probably damaging Het
Ccdc65 A T 15: 98,616,723 (GRCm39) K204* probably null Het
Cdk5 T A 5: 24,627,379 (GRCm39) K88M probably damaging Het
Cdrt4 T A 11: 62,883,634 (GRCm39) L112Q probably damaging Het
Cenpb T C 2: 131,020,547 (GRCm39) E417G unknown Het
Cep135 T C 5: 76,754,576 (GRCm39) I351T possibly damaging Het
Ces1d A T 8: 93,914,383 (GRCm39) S226R probably damaging Het
Cfap97 T A 8: 46,623,114 (GRCm39) V168E possibly damaging Het
CN725425 T C 15: 91,130,090 (GRCm39) C318R possibly damaging Het
Cnga3 T A 1: 37,300,460 (GRCm39) D393E probably benign Het
Cplane1 A T 15: 8,230,765 (GRCm39) H1014L possibly damaging Het
Cpsf1 G A 15: 76,486,169 (GRCm39) R358* probably null Het
Cyp2b23 G A 7: 26,378,963 (GRCm39) P167L probably damaging Het
Cyp2c70 A T 19: 40,142,059 (GRCm39) H477Q probably benign Het
D930020B18Rik A C 10: 121,490,721 (GRCm39) Y107S probably damaging Het
Dhrs1 A T 14: 55,978,192 (GRCm39) F216I probably benign Het
Dmgdh A T 13: 93,845,767 (GRCm39) K474* probably null Het
Dsp T C 13: 38,335,596 (GRCm39) I11T possibly damaging Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,077,444 (GRCm39) probably benign Het
Grid2 A C 6: 64,643,139 (GRCm39) H967P probably benign Het
Hc A G 2: 34,922,317 (GRCm39) I503T possibly damaging Het
Herc3 T C 6: 58,867,183 (GRCm39) L824S probably damaging Het
Hfm1 T C 5: 107,065,439 (GRCm39) D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspa1l A G 17: 35,196,230 (GRCm39) K90E possibly damaging Het
Impa2 G A 18: 67,451,497 (GRCm39) V264I probably benign Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Klhl38 C T 15: 58,185,500 (GRCm39) V410I probably benign Het
Lcn4 A G 2: 26,558,360 (GRCm39) I175T possibly damaging Het
Lipo2 C A 19: 33,726,917 (GRCm39) W40L probably damaging Het
Mgam A T 6: 40,734,745 (GRCm39) probably null Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4a66 T A 2: 88,531,137 (GRCm39) I179F probably benign Het
Or52e19b A T 7: 103,032,667 (GRCm39) C181S probably damaging Het
Or5j3 G A 2: 86,128,526 (GRCm39) R122H probably benign Het
Pcdha11 A G 18: 37,145,307 (GRCm39) N466S probably damaging Het
Pif1 C T 9: 65,499,076 (GRCm39) T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 110,350,420 (GRCm39) probably benign Het
Pole T C 5: 110,459,949 (GRCm39) S1118P possibly damaging Het
Ppp4r4 T C 12: 103,566,706 (GRCm39) M652T probably benign Het
Prex2 A T 1: 11,180,562 (GRCm39) K376* probably null Het
Prps1l1 A T 12: 35,035,205 (GRCm39) I107F probably damaging Het
Resf1 T A 6: 149,228,664 (GRCm39) V570D probably damaging Het
Rfc1 C T 5: 65,432,778 (GRCm39) V761I probably benign Het
Ripk4 T C 16: 97,547,203 (GRCm39) E353G probably benign Het
Robo2 C A 16: 73,767,941 (GRCm39) probably null Het
Rrm1 C T 7: 102,117,545 (GRCm39) A745V probably benign Het
Sash1 A T 10: 8,606,179 (GRCm39) V737D probably benign Het
Sel1l2 T C 2: 140,127,209 (GRCm39) K101E probably benign Het
Selenbp2 A T 3: 94,607,337 (GRCm39) I253F probably benign Het
Setd1a C T 7: 127,385,279 (GRCm39) P662L possibly damaging Het
Slc16a6 C T 11: 109,345,776 (GRCm39) V496I possibly damaging Het
Slc4a4 A T 5: 89,232,512 (GRCm39) M239L probably benign Het
Slc7a8 G C 14: 55,018,750 (GRCm39) A12G probably benign Het
Snx30 T C 4: 59,886,517 (GRCm39) S309P possibly damaging Het
Spen T C 4: 141,197,701 (GRCm39) N3389S probably benign Het
Spg11 T C 2: 121,922,687 (GRCm39) T921A probably damaging Het
Tanc2 T A 11: 105,758,400 (GRCm39) D720E possibly damaging Het
Tmprss9 A T 10: 80,730,163 (GRCm39) I688F possibly damaging Het
Trap1 A G 16: 3,862,490 (GRCm39) V596A possibly damaging Het
Ttc32 G T 12: 9,080,187 (GRCm39) R44L probably benign Het
Tusc3 T A 8: 39,597,898 (GRCm39) N288K probably benign Het
Ush2a G A 1: 188,127,956 (GRCm39) G656E probably damaging Het
Vill T C 9: 118,892,671 (GRCm39) probably null Het
Vmn1r5 A T 6: 56,963,182 (GRCm39) R286* probably null Het
Vmn2r14 T C 5: 109,365,533 (GRCm39) T514A probably benign Het
Vmn2r32 G A 7: 7,477,204 (GRCm39) H396Y probably benign Het
Vmn2r75 A T 7: 85,820,765 (GRCm39) Y56* probably null Het
Wdfy3 C T 5: 102,011,983 (GRCm39) S2668N probably benign Het
Wdr72 G A 9: 74,059,729 (GRCm39) D392N probably benign Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10,488,889 (GRCm39) missense probably damaging 1.00
IGL00567:Myo16 APN 8 10,512,154 (GRCm39) missense probably damaging 1.00
IGL00671:Myo16 APN 8 10,411,067 (GRCm39) missense probably damaging 1.00
IGL00897:Myo16 APN 8 10,365,518 (GRCm39) missense probably damaging 1.00
IGL01458:Myo16 APN 8 10,485,853 (GRCm39) missense probably damaging 1.00
IGL01523:Myo16 APN 8 10,420,908 (GRCm39) missense probably damaging 1.00
IGL01532:Myo16 APN 8 10,450,551 (GRCm39) missense probably benign 0.00
IGL01680:Myo16 APN 8 10,322,630 (GRCm39) missense probably damaging 1.00
IGL01747:Myo16 APN 8 10,654,877 (GRCm39) missense probably damaging 1.00
IGL02084:Myo16 APN 8 10,411,088 (GRCm39) missense probably damaging 0.99
IGL02203:Myo16 APN 8 10,620,132 (GRCm39) missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10,440,217 (GRCm39) missense probably damaging 1.00
IGL02819:Myo16 APN 8 10,372,600 (GRCm39) missense probably damaging 1.00
IGL02935:Myo16 APN 8 10,582,990 (GRCm39) missense probably benign 0.41
IGL02943:Myo16 APN 8 10,450,595 (GRCm39) splice site probably benign
IGL03347:Myo16 APN 8 10,426,120 (GRCm39) critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10,488,869 (GRCm39) missense probably damaging 0.99
P0016:Myo16 UTSW 8 10,450,596 (GRCm39) splice site probably benign
R0006:Myo16 UTSW 8 10,525,988 (GRCm39) missense probably damaging 0.98
R0006:Myo16 UTSW 8 10,525,988 (GRCm39) missense probably damaging 0.98
R0033:Myo16 UTSW 8 10,420,955 (GRCm39) missense probably damaging 1.00
R0033:Myo16 UTSW 8 10,420,955 (GRCm39) missense probably damaging 1.00
R0142:Myo16 UTSW 8 10,619,790 (GRCm39) missense probably benign 0.01
R0195:Myo16 UTSW 8 10,365,538 (GRCm39) splice site probably benign
R0418:Myo16 UTSW 8 10,619,918 (GRCm39) missense probably benign 0.01
R0576:Myo16 UTSW 8 10,612,318 (GRCm39) critical splice donor site probably null
R0627:Myo16 UTSW 8 10,489,689 (GRCm39) missense probably benign 0.15
R0826:Myo16 UTSW 8 10,426,285 (GRCm39) splice site probably benign
R0835:Myo16 UTSW 8 10,322,766 (GRCm39) missense probably damaging 1.00
R1015:Myo16 UTSW 8 10,440,183 (GRCm39) missense probably benign 0.17
R1052:Myo16 UTSW 8 10,620,181 (GRCm39) missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10,446,908 (GRCm39) missense probably damaging 1.00
R1185:Myo16 UTSW 8 10,683,624 (GRCm39) missense probably damaging 1.00
R1185:Myo16 UTSW 8 10,683,624 (GRCm39) missense probably damaging 1.00
R1474:Myo16 UTSW 8 10,552,796 (GRCm39) missense probably damaging 1.00
R1484:Myo16 UTSW 8 10,610,145 (GRCm39) missense probably damaging 1.00
R1503:Myo16 UTSW 8 10,552,817 (GRCm39) missense probably benign 0.44
R1733:Myo16 UTSW 8 10,492,283 (GRCm39) missense probably damaging 0.98
R1873:Myo16 UTSW 8 10,322,789 (GRCm39) missense probably damaging 1.00
R1885:Myo16 UTSW 8 10,372,656 (GRCm39) missense probably damaging 1.00
R1943:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10,552,796 (GRCm39) missense probably damaging 1.00
R2019:Myo16 UTSW 8 10,426,260 (GRCm39) missense probably benign 0.05
R2022:Myo16 UTSW 8 10,322,633 (GRCm39) missense probably benign 0.08
R2214:Myo16 UTSW 8 10,488,803 (GRCm39) missense probably damaging 1.00
R2228:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10,644,905 (GRCm39) missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10,644,820 (GRCm39) missense probably benign 0.43
R3402:Myo16 UTSW 8 10,434,719 (GRCm39) missense probably benign
R3870:Myo16 UTSW 8 10,492,239 (GRCm39) missense probably benign 0.25
R4080:Myo16 UTSW 8 10,612,240 (GRCm39) missense probably damaging 1.00
R4498:Myo16 UTSW 8 10,485,869 (GRCm39) missense probably benign 0.01
R4631:Myo16 UTSW 8 10,556,984 (GRCm39) missense probably damaging 1.00
R4689:Myo16 UTSW 8 10,488,890 (GRCm39) missense probably damaging 1.00
R4736:Myo16 UTSW 8 10,423,527 (GRCm39) missense probably damaging 1.00
R4738:Myo16 UTSW 8 10,423,527 (GRCm39) missense probably damaging 1.00
R4739:Myo16 UTSW 8 10,423,527 (GRCm39) missense probably damaging 1.00
R4764:Myo16 UTSW 8 10,485,880 (GRCm39) missense probably damaging 1.00
R4778:Myo16 UTSW 8 10,619,694 (GRCm39) missense probably damaging 0.97
R4852:Myo16 UTSW 8 10,423,474 (GRCm39) missense probably damaging 1.00
R4885:Myo16 UTSW 8 10,488,892 (GRCm39) missense probably damaging 0.98
R4993:Myo16 UTSW 8 10,526,094 (GRCm39) missense probably damaging 0.99
R5077:Myo16 UTSW 8 10,372,658 (GRCm39) missense probably damaging 1.00
R5135:Myo16 UTSW 8 10,526,114 (GRCm39) missense probably benign
R5170:Myo16 UTSW 8 10,619,745 (GRCm39) missense probably benign 0.30
R5203:Myo16 UTSW 8 10,410,995 (GRCm39) missense probably damaging 1.00
R5246:Myo16 UTSW 8 10,612,212 (GRCm39) nonsense probably null
R5517:Myo16 UTSW 8 10,610,226 (GRCm39) missense probably benign 0.22
R5567:Myo16 UTSW 8 10,372,676 (GRCm39) missense probably damaging 1.00
R5694:Myo16 UTSW 8 10,619,606 (GRCm39) missense probably benign 0.01
R5749:Myo16 UTSW 8 10,463,245 (GRCm39) missense probably benign 0.01
R6131:Myo16 UTSW 8 10,619,877 (GRCm39) missense probably benign
R6213:Myo16 UTSW 8 10,420,963 (GRCm39) critical splice donor site probably null
R6216:Myo16 UTSW 8 10,365,494 (GRCm39) missense probably benign 0.01
R6240:Myo16 UTSW 8 10,420,930 (GRCm39) missense probably damaging 1.00
R6628:Myo16 UTSW 8 10,620,638 (GRCm39) missense probably damaging 0.99
R6935:Myo16 UTSW 8 10,619,820 (GRCm39) missense probably benign 0.37
R6996:Myo16 UTSW 8 10,619,496 (GRCm39) missense probably damaging 1.00
R7103:Myo16 UTSW 8 10,619,673 (GRCm39) missense unknown
R7164:Myo16 UTSW 8 10,619,585 (GRCm39) missense unknown
R7255:Myo16 UTSW 8 10,549,169 (GRCm39) missense unknown
R7266:Myo16 UTSW 8 10,322,687 (GRCm39) missense unknown
R7319:Myo16 UTSW 8 10,526,185 (GRCm39) splice site probably null
R7398:Myo16 UTSW 8 10,612,183 (GRCm39) missense unknown
R7442:Myo16 UTSW 8 10,322,537 (GRCm39) missense probably damaging 1.00
R7498:Myo16 UTSW 8 10,450,589 (GRCm39) missense unknown
R7539:Myo16 UTSW 8 10,411,095 (GRCm39) critical splice donor site probably null
R7622:Myo16 UTSW 8 10,426,238 (GRCm39) missense unknown
R7794:Myo16 UTSW 8 10,619,913 (GRCm39) missense unknown
R7903:Myo16 UTSW 8 10,426,265 (GRCm39) missense probably null
R8055:Myo16 UTSW 8 10,612,186 (GRCm39) missense unknown
R8078:Myo16 UTSW 8 10,612,078 (GRCm39) missense unknown
R8081:Myo16 UTSW 8 10,372,743 (GRCm39) missense unknown
R8679:Myo16 UTSW 8 10,411,042 (GRCm39) missense unknown
R8700:Myo16 UTSW 8 10,463,172 (GRCm39) missense unknown
R8939:Myo16 UTSW 8 10,524,679 (GRCm39) missense probably damaging 0.99
R8955:Myo16 UTSW 8 10,426,175 (GRCm39) missense probably damaging 1.00
R9187:Myo16 UTSW 8 10,492,233 (GRCm39) missense unknown
R9219:Myo16 UTSW 8 10,492,236 (GRCm39) missense unknown
R9287:Myo16 UTSW 8 10,526,114 (GRCm39) missense unknown
R9327:Myo16 UTSW 8 10,489,705 (GRCm39) critical splice donor site probably null
R9763:Myo16 UTSW 8 10,450,528 (GRCm39) missense unknown
R9765:Myo16 UTSW 8 10,620,401 (GRCm39) missense probably damaging 0.97
R9790:Myo16 UTSW 8 10,619,925 (GRCm39) missense unknown
R9791:Myo16 UTSW 8 10,619,925 (GRCm39) missense unknown
X0066:Myo16 UTSW 8 10,426,185 (GRCm39) missense probably damaging 1.00
Z1177:Myo16 UTSW 8 10,524,691 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTCGGAAGCCAAAGAGAAGTCC -3'
(R):5'- CCTCCAAGATGATGGCTTTTCG -3'

Sequencing Primer
(F):5'- ACACGAAGCTCAGTGGCTCTTATG -3'
(R):5'- CCAAGATGATGGCTTTTCGAGTCTC -3'
Posted On 2021-10-11