Incidental Mutation 'R8968:Pkd1l3'
ID 682862
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Name polycystic kidney disease 1 like 3
Synonyms
MMRRC Submission 068802-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8968 (G1)
Quality Score 214.458
Status Not validated
Chromosome 8
Chromosomal Location 110340828-110399305 bp(+) (GRCm39)
Type of Mutation small deletion (13 aa in frame mutation)
DNA Base Change (assembly) CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA to CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA at 110350420 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
AlphaFold Q2EG98
Predicted Effect probably benign
Transcript: ENSMUST00000057344
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109242
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212537
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,480,429 (GRCm39) L1153* probably null Het
Adamts2 T C 11: 50,683,550 (GRCm39) I944T possibly damaging Het
Aqp9 A T 9: 71,045,485 (GRCm39) C67* probably null Het
Armt1 G T 10: 4,404,150 (GRCm39) G412W probably damaging Het
B4galt1 T C 4: 40,807,243 (GRCm39) D381G probably benign Het
Bmp5 A T 9: 75,780,579 (GRCm39) H292L probably benign Het
Brpf1 T C 6: 113,299,510 (GRCm39) F1181S probably damaging Het
Btbd7 C A 12: 102,779,025 (GRCm39) G414C probably damaging Het
Ccdc65 A T 15: 98,616,723 (GRCm39) K204* probably null Het
Cdk5 T A 5: 24,627,379 (GRCm39) K88M probably damaging Het
Cdrt4 T A 11: 62,883,634 (GRCm39) L112Q probably damaging Het
Cenpb T C 2: 131,020,547 (GRCm39) E417G unknown Het
Cep135 T C 5: 76,754,576 (GRCm39) I351T possibly damaging Het
Ces1d A T 8: 93,914,383 (GRCm39) S226R probably damaging Het
Cfap97 T A 8: 46,623,114 (GRCm39) V168E possibly damaging Het
CN725425 T C 15: 91,130,090 (GRCm39) C318R possibly damaging Het
Cnga3 T A 1: 37,300,460 (GRCm39) D393E probably benign Het
Cplane1 A T 15: 8,230,765 (GRCm39) H1014L possibly damaging Het
Cpsf1 G A 15: 76,486,169 (GRCm39) R358* probably null Het
Cyp2b23 G A 7: 26,378,963 (GRCm39) P167L probably damaging Het
Cyp2c70 A T 19: 40,142,059 (GRCm39) H477Q probably benign Het
D930020B18Rik A C 10: 121,490,721 (GRCm39) Y107S probably damaging Het
Dhrs1 A T 14: 55,978,192 (GRCm39) F216I probably benign Het
Dmgdh A T 13: 93,845,767 (GRCm39) K474* probably null Het
Dsp T C 13: 38,335,596 (GRCm39) I11T possibly damaging Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,077,444 (GRCm39) probably benign Het
Grid2 A C 6: 64,643,139 (GRCm39) H967P probably benign Het
Hc A G 2: 34,922,317 (GRCm39) I503T possibly damaging Het
Herc3 T C 6: 58,867,183 (GRCm39) L824S probably damaging Het
Hfm1 T C 5: 107,065,439 (GRCm39) D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspa1l A G 17: 35,196,230 (GRCm39) K90E possibly damaging Het
Impa2 G A 18: 67,451,497 (GRCm39) V264I probably benign Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Klhl38 C T 15: 58,185,500 (GRCm39) V410I probably benign Het
Lcn4 A G 2: 26,558,360 (GRCm39) I175T possibly damaging Het
Lipo2 C A 19: 33,726,917 (GRCm39) W40L probably damaging Het
Mgam A T 6: 40,734,745 (GRCm39) probably null Het
Myo16 T A 8: 10,619,700 (GRCm39) I1417N unknown Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4a66 T A 2: 88,531,137 (GRCm39) I179F probably benign Het
Or52e19b A T 7: 103,032,667 (GRCm39) C181S probably damaging Het
Or5j3 G A 2: 86,128,526 (GRCm39) R122H probably benign Het
Pcdha11 A G 18: 37,145,307 (GRCm39) N466S probably damaging Het
Pif1 C T 9: 65,499,076 (GRCm39) T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pole T C 5: 110,459,949 (GRCm39) S1118P possibly damaging Het
Ppp4r4 T C 12: 103,566,706 (GRCm39) M652T probably benign Het
Prex2 A T 1: 11,180,562 (GRCm39) K376* probably null Het
Prps1l1 A T 12: 35,035,205 (GRCm39) I107F probably damaging Het
Resf1 T A 6: 149,228,664 (GRCm39) V570D probably damaging Het
Rfc1 C T 5: 65,432,778 (GRCm39) V761I probably benign Het
Ripk4 T C 16: 97,547,203 (GRCm39) E353G probably benign Het
Robo2 C A 16: 73,767,941 (GRCm39) probably null Het
Rrm1 C T 7: 102,117,545 (GRCm39) A745V probably benign Het
Sash1 A T 10: 8,606,179 (GRCm39) V737D probably benign Het
Sel1l2 T C 2: 140,127,209 (GRCm39) K101E probably benign Het
Selenbp2 A T 3: 94,607,337 (GRCm39) I253F probably benign Het
Setd1a C T 7: 127,385,279 (GRCm39) P662L possibly damaging Het
Slc16a6 C T 11: 109,345,776 (GRCm39) V496I possibly damaging Het
Slc4a4 A T 5: 89,232,512 (GRCm39) M239L probably benign Het
Slc7a8 G C 14: 55,018,750 (GRCm39) A12G probably benign Het
Snx30 T C 4: 59,886,517 (GRCm39) S309P possibly damaging Het
Spen T C 4: 141,197,701 (GRCm39) N3389S probably benign Het
Spg11 T C 2: 121,922,687 (GRCm39) T921A probably damaging Het
Tanc2 T A 11: 105,758,400 (GRCm39) D720E possibly damaging Het
Tmprss9 A T 10: 80,730,163 (GRCm39) I688F possibly damaging Het
Trap1 A G 16: 3,862,490 (GRCm39) V596A possibly damaging Het
Ttc32 G T 12: 9,080,187 (GRCm39) R44L probably benign Het
Tusc3 T A 8: 39,597,898 (GRCm39) N288K probably benign Het
Ush2a G A 1: 188,127,956 (GRCm39) G656E probably damaging Het
Vill T C 9: 118,892,671 (GRCm39) probably null Het
Vmn1r5 A T 6: 56,963,182 (GRCm39) R286* probably null Het
Vmn2r14 T C 5: 109,365,533 (GRCm39) T514A probably benign Het
Vmn2r32 G A 7: 7,477,204 (GRCm39) H396Y probably benign Het
Vmn2r75 A T 7: 85,820,765 (GRCm39) Y56* probably null Het
Wdfy3 C T 5: 102,011,983 (GRCm39) S2668N probably benign Het
Wdr72 G A 9: 74,059,729 (GRCm39) D392N probably benign Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 110,356,869 (GRCm39) missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 110,382,779 (GRCm39) missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 110,382,779 (GRCm39) missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 110,365,338 (GRCm39) missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 110,388,873 (GRCm39) missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 110,350,403 (GRCm39) missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 110,350,153 (GRCm39) missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 110,394,157 (GRCm39) critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 110,361,934 (GRCm39) missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 110,375,134 (GRCm39) critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 110,356,798 (GRCm39) missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 110,357,908 (GRCm39) critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 110,361,933 (GRCm39) missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 110,387,438 (GRCm39) missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 110,358,010 (GRCm39) missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 110,362,012 (GRCm39) missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 110,392,217 (GRCm39) missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 110,395,924 (GRCm39) missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 110,365,296 (GRCm39) missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 110,357,977 (GRCm39) missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 110,387,434 (GRCm39) missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 110,365,310 (GRCm39) missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 110,357,708 (GRCm39) missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 110,373,129 (GRCm39) unclassified probably benign
IGL02358:Pkd1l3 APN 8 110,373,129 (GRCm39) unclassified probably benign
IGL02369:Pkd1l3 APN 8 110,342,977 (GRCm39) missense unknown
IGL02481:Pkd1l3 APN 8 110,341,414 (GRCm39) missense unknown
IGL02505:Pkd1l3 APN 8 110,359,848 (GRCm39) missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 110,374,132 (GRCm39) missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 110,367,522 (GRCm39) nonsense probably null
IGL02715:Pkd1l3 APN 8 110,353,458 (GRCm39) missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 110,388,736 (GRCm39) splice site probably benign
IGL03059:Pkd1l3 APN 8 110,374,999 (GRCm39) missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 110,382,165 (GRCm39) nonsense probably null
IGL03206:Pkd1l3 APN 8 110,350,345 (GRCm39) missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 110,388,738 (GRCm39) splice site probably benign
BB006:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
PIT4453001:Pkd1l3 UTSW 8 110,387,433 (GRCm39) missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 110,391,131 (GRCm39) missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 110,355,265 (GRCm39) splice site probably benign
R0066:Pkd1l3 UTSW 8 110,347,103 (GRCm39) missense unknown
R0066:Pkd1l3 UTSW 8 110,347,103 (GRCm39) missense unknown
R0233:Pkd1l3 UTSW 8 110,377,412 (GRCm39) nonsense probably null
R0233:Pkd1l3 UTSW 8 110,377,412 (GRCm39) nonsense probably null
R0255:Pkd1l3 UTSW 8 110,365,386 (GRCm39) missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 110,373,131 (GRCm39) splice site probably null
R0311:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0311:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0403:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0441:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0465:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0466:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0488:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0515:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0534:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 110,348,340 (GRCm39) missense unknown
R1464:Pkd1l3 UTSW 8 110,363,059 (GRCm39) splice site probably benign
R1467:Pkd1l3 UTSW 8 110,343,000 (GRCm39) missense unknown
R1467:Pkd1l3 UTSW 8 110,343,000 (GRCm39) missense unknown
R1469:Pkd1l3 UTSW 8 110,373,585 (GRCm39) missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 110,373,585 (GRCm39) missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 110,367,402 (GRCm39) missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 110,341,445 (GRCm39) missense unknown
R1574:Pkd1l3 UTSW 8 110,341,445 (GRCm39) missense unknown
R1599:Pkd1l3 UTSW 8 110,363,016 (GRCm39) missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 110,350,450 (GRCm39) missense probably benign 0.18
R1792:Pkd1l3 UTSW 8 110,359,237 (GRCm39) missense probably damaging 1.00
R1818:Pkd1l3 UTSW 8 110,375,038 (GRCm39) missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 110,350,831 (GRCm39) missense possibly damaging 0.92
R2105:Pkd1l3 UTSW 8 110,374,205 (GRCm39) nonsense probably null
R2185:Pkd1l3 UTSW 8 110,359,827 (GRCm39) missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 110,347,156 (GRCm39) missense unknown
R2260:Pkd1l3 UTSW 8 110,350,268 (GRCm39) missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 110,355,341 (GRCm39) missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 110,397,353 (GRCm39) makesense probably null
R2435:Pkd1l3 UTSW 8 110,377,334 (GRCm39) missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 110,350,447 (GRCm39) missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 110,350,622 (GRCm39) missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 110,394,268 (GRCm39) splice site probably benign
R3755:Pkd1l3 UTSW 8 110,359,171 (GRCm39) missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 110,362,949 (GRCm39) missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 110,373,511 (GRCm39) missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 110,350,751 (GRCm39) missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 110,359,345 (GRCm39) splice site probably null
R4893:Pkd1l3 UTSW 8 110,365,026 (GRCm39) missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 110,367,475 (GRCm39) missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 110,392,268 (GRCm39) missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 110,349,787 (GRCm39) missense unknown
R5207:Pkd1l3 UTSW 8 110,359,823 (GRCm39) missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 110,367,424 (GRCm39) missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 110,393,684 (GRCm39) missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 110,382,152 (GRCm39) missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 110,356,842 (GRCm39) missense probably benign
R5623:Pkd1l3 UTSW 8 110,350,351 (GRCm39) missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 110,353,468 (GRCm39) missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 110,367,478 (GRCm39) missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 110,367,478 (GRCm39) missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 110,349,811 (GRCm39) missense unknown
R6330:Pkd1l3 UTSW 8 110,373,541 (GRCm39) missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 110,358,016 (GRCm39) missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 110,350,595 (GRCm39) missense probably benign 0.20
R6475:Pkd1l3 UTSW 8 110,349,844 (GRCm39) missense unknown
R6480:Pkd1l3 UTSW 8 110,365,019 (GRCm39) nonsense probably null
R6519:Pkd1l3 UTSW 8 110,355,404 (GRCm39) missense probably benign
R6654:Pkd1l3 UTSW 8 110,350,915 (GRCm39) missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 110,341,401 (GRCm39) missense unknown
R6733:Pkd1l3 UTSW 8 110,375,126 (GRCm39) splice site probably null
R6753:Pkd1l3 UTSW 8 110,351,081 (GRCm39) missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 110,353,446 (GRCm39) missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 110,341,246 (GRCm39) missense unknown
R6975:Pkd1l3 UTSW 8 110,387,539 (GRCm39) missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7018:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7083:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7139:Pkd1l3 UTSW 8 110,362,972 (GRCm39) missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7235:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7238:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7252:Pkd1l3 UTSW 8 110,387,330 (GRCm39) missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7309:Pkd1l3 UTSW 8 110,374,893 (GRCm39) splice site probably null
R7362:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7462:Pkd1l3 UTSW 8 110,355,409 (GRCm39) missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 110,365,008 (GRCm39) missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 110,359,947 (GRCm39) missense probably damaging 1.00
R7483:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7516:Pkd1l3 UTSW 8 110,361,861 (GRCm39) missense probably damaging 1.00
R7553:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7559:Pkd1l3 UTSW 8 110,351,072 (GRCm39) missense probably benign 0.03
R7650:Pkd1l3 UTSW 8 110,399,217 (GRCm39) missense probably benign 0.23
R7654:Pkd1l3 UTSW 8 110,365,049 (GRCm39) missense probably damaging 1.00
R7742:Pkd1l3 UTSW 8 110,341,204 (GRCm39) missense unknown
R7749:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7751:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7755:Pkd1l3 UTSW 8 110,356,798 (GRCm39) missense possibly damaging 0.85
R7816:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7831:Pkd1l3 UTSW 8 110,357,990 (GRCm39) missense possibly damaging 0.47
R7835:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7849:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R7917:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7929:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7952:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8054:Pkd1l3 UTSW 8 110,373,008 (GRCm39) missense probably damaging 1.00
R8098:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8099:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8276:Pkd1l3 UTSW 8 110,397,353 (GRCm39) makesense probably null
R8352:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8376:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R8377:Pkd1l3 UTSW 8 110,361,982 (GRCm39) missense probably benign 0.08
R8398:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8399:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8400:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8412:Pkd1l3 UTSW 8 110,360,022 (GRCm39) missense possibly damaging 0.85
R8530:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8539:Pkd1l3 UTSW 8 110,362,919 (GRCm39) missense probably damaging 1.00
R8546:Pkd1l3 UTSW 8 110,393,615 (GRCm39) missense possibly damaging 0.52
R8558:Pkd1l3 UTSW 8 110,362,012 (GRCm39) missense probably damaging 1.00
R8719:Pkd1l3 UTSW 8 110,341,255 (GRCm39) missense unknown
R8769:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8797:Pkd1l3 UTSW 8 110,374,946 (GRCm39) missense probably benign 0.15
R8840:Pkd1l3 UTSW 8 110,349,842 (GRCm39) missense unknown
R8846:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8874:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8893:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8956:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8963:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9035:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9054:Pkd1l3 UTSW 8 110,392,304 (GRCm39) missense probably benign 0.08
R9058:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9119:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9134:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9138:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9158:Pkd1l3 UTSW 8 110,394,207 (GRCm39) nonsense probably null
R9180:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9181:Pkd1l3 UTSW 8 110,375,318 (GRCm39) missense probably damaging 0.98
R9218:Pkd1l3 UTSW 8 110,382,128 (GRCm39) nonsense probably null
R9249:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9269:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9338:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9383:Pkd1l3 UTSW 8 110,350,601 (GRCm39) small deletion probably benign
R9396:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9423:Pkd1l3 UTSW 8 110,350,312 (GRCm39) missense possibly damaging 0.53
R9514:Pkd1l3 UTSW 8 110,395,849 (GRCm39) missense probably damaging 1.00
R9515:Pkd1l3 UTSW 8 110,395,849 (GRCm39) missense probably damaging 1.00
R9567:Pkd1l3 UTSW 8 110,394,173 (GRCm39) missense probably damaging 0.99
R9668:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9684:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9748:Pkd1l3 UTSW 8 110,373,555 (GRCm39) missense probably benign 0.00
R9778:Pkd1l3 UTSW 8 110,357,937 (GRCm39) missense probably benign 0.00
RF016:Pkd1l3 UTSW 8 110,350,174 (GRCm39) missense probably benign 0.18
RF029:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
X0026:Pkd1l3 UTSW 8 110,341,185 (GRCm39) missense probably null
Z1176:Pkd1l3 UTSW 8 110,349,874 (GRCm39) missense unknown
Z31818:Pkd1l3 UTSW 8 110,395,924 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGACATTAGACACACCTTC -3'
(R):5'- CAGGTGTGTCTGATGTCACC -3'

Sequencing Primer
(F):5'- GGGACATTAGACACACCTTCATCTAG -3'
(R):5'- GATACAAGTGTGGCTGTTGTC -3'
Posted On 2021-10-11