Incidental Mutation 'R8968:Tmprss9'
ID 682871
Institutional Source Beutler Lab
Gene Symbol Tmprss9
Ensembl Gene ENSMUSG00000059406
Gene Name transmembrane protease, serine 9
Synonyms Serase-1B
MMRRC Submission 068802-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R8968 (G1)
Quality Score 154.008
Status Not validated
Chromosome 10
Chromosomal Location 80707682-80735326 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80730163 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 688 (I688F)
Ref Sequence ENSEMBL: ENSMUSP00000100970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105333] [ENSMUST00000219817]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000105333
AA Change: I688F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406
AA Change: I688F

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000219817
AA Change: I688F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound type II serine polyprotease that is cleaved to release three different proteases. Two of the proteases are active and can be inhibited by serine protease inhibitors, and one is thought to be catalytically inactive. This gene enhances the invasive capability of pancreatic cancer cells and may be involved in cancer progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,480,429 (GRCm39) L1153* probably null Het
Adamts2 T C 11: 50,683,550 (GRCm39) I944T possibly damaging Het
Aqp9 A T 9: 71,045,485 (GRCm39) C67* probably null Het
Armt1 G T 10: 4,404,150 (GRCm39) G412W probably damaging Het
B4galt1 T C 4: 40,807,243 (GRCm39) D381G probably benign Het
Bmp5 A T 9: 75,780,579 (GRCm39) H292L probably benign Het
Brpf1 T C 6: 113,299,510 (GRCm39) F1181S probably damaging Het
Btbd7 C A 12: 102,779,025 (GRCm39) G414C probably damaging Het
Ccdc65 A T 15: 98,616,723 (GRCm39) K204* probably null Het
Cdk5 T A 5: 24,627,379 (GRCm39) K88M probably damaging Het
Cdrt4 T A 11: 62,883,634 (GRCm39) L112Q probably damaging Het
Cenpb T C 2: 131,020,547 (GRCm39) E417G unknown Het
Cep135 T C 5: 76,754,576 (GRCm39) I351T possibly damaging Het
Ces1d A T 8: 93,914,383 (GRCm39) S226R probably damaging Het
Cfap97 T A 8: 46,623,114 (GRCm39) V168E possibly damaging Het
CN725425 T C 15: 91,130,090 (GRCm39) C318R possibly damaging Het
Cnga3 T A 1: 37,300,460 (GRCm39) D393E probably benign Het
Cplane1 A T 15: 8,230,765 (GRCm39) H1014L possibly damaging Het
Cpsf1 G A 15: 76,486,169 (GRCm39) R358* probably null Het
Cyp2b23 G A 7: 26,378,963 (GRCm39) P167L probably damaging Het
Cyp2c70 A T 19: 40,142,059 (GRCm39) H477Q probably benign Het
D930020B18Rik A C 10: 121,490,721 (GRCm39) Y107S probably damaging Het
Dhrs1 A T 14: 55,978,192 (GRCm39) F216I probably benign Het
Dmgdh A T 13: 93,845,767 (GRCm39) K474* probably null Het
Dsp T C 13: 38,335,596 (GRCm39) I11T possibly damaging Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,077,444 (GRCm39) probably benign Het
Grid2 A C 6: 64,643,139 (GRCm39) H967P probably benign Het
Hc A G 2: 34,922,317 (GRCm39) I503T possibly damaging Het
Herc3 T C 6: 58,867,183 (GRCm39) L824S probably damaging Het
Hfm1 T C 5: 107,065,439 (GRCm39) D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspa1l A G 17: 35,196,230 (GRCm39) K90E possibly damaging Het
Impa2 G A 18: 67,451,497 (GRCm39) V264I probably benign Het
Ipmk C T 10: 71,199,333 (GRCm39) R65W probably damaging Het
Klhl38 C T 15: 58,185,500 (GRCm39) V410I probably benign Het
Lcn4 A G 2: 26,558,360 (GRCm39) I175T possibly damaging Het
Lipo2 C A 19: 33,726,917 (GRCm39) W40L probably damaging Het
Mgam A T 6: 40,734,745 (GRCm39) probably null Het
Myo16 T A 8: 10,619,700 (GRCm39) I1417N unknown Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4a66 T A 2: 88,531,137 (GRCm39) I179F probably benign Het
Or52e19b A T 7: 103,032,667 (GRCm39) C181S probably damaging Het
Or5j3 G A 2: 86,128,526 (GRCm39) R122H probably benign Het
Pcdha11 A G 18: 37,145,307 (GRCm39) N466S probably damaging Het
Pif1 C T 9: 65,499,076 (GRCm39) T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 110,350,420 (GRCm39) probably benign Het
Pole T C 5: 110,459,949 (GRCm39) S1118P possibly damaging Het
Ppp4r4 T C 12: 103,566,706 (GRCm39) M652T probably benign Het
Prex2 A T 1: 11,180,562 (GRCm39) K376* probably null Het
Prps1l1 A T 12: 35,035,205 (GRCm39) I107F probably damaging Het
Resf1 T A 6: 149,228,664 (GRCm39) V570D probably damaging Het
Rfc1 C T 5: 65,432,778 (GRCm39) V761I probably benign Het
Ripk4 T C 16: 97,547,203 (GRCm39) E353G probably benign Het
Robo2 C A 16: 73,767,941 (GRCm39) probably null Het
Rrm1 C T 7: 102,117,545 (GRCm39) A745V probably benign Het
Sash1 A T 10: 8,606,179 (GRCm39) V737D probably benign Het
Sel1l2 T C 2: 140,127,209 (GRCm39) K101E probably benign Het
Selenbp2 A T 3: 94,607,337 (GRCm39) I253F probably benign Het
Setd1a C T 7: 127,385,279 (GRCm39) P662L possibly damaging Het
Slc16a6 C T 11: 109,345,776 (GRCm39) V496I possibly damaging Het
Slc4a4 A T 5: 89,232,512 (GRCm39) M239L probably benign Het
Slc7a8 G C 14: 55,018,750 (GRCm39) A12G probably benign Het
Snx30 T C 4: 59,886,517 (GRCm39) S309P possibly damaging Het
Spen T C 4: 141,197,701 (GRCm39) N3389S probably benign Het
Spg11 T C 2: 121,922,687 (GRCm39) T921A probably damaging Het
Tanc2 T A 11: 105,758,400 (GRCm39) D720E possibly damaging Het
Trap1 A G 16: 3,862,490 (GRCm39) V596A possibly damaging Het
Ttc32 G T 12: 9,080,187 (GRCm39) R44L probably benign Het
Tusc3 T A 8: 39,597,898 (GRCm39) N288K probably benign Het
Ush2a G A 1: 188,127,956 (GRCm39) G656E probably damaging Het
Vill T C 9: 118,892,671 (GRCm39) probably null Het
Vmn1r5 A T 6: 56,963,182 (GRCm39) R286* probably null Het
Vmn2r14 T C 5: 109,365,533 (GRCm39) T514A probably benign Het
Vmn2r32 G A 7: 7,477,204 (GRCm39) H396Y probably benign Het
Vmn2r75 A T 7: 85,820,765 (GRCm39) Y56* probably null Het
Wdfy3 C T 5: 102,011,983 (GRCm39) S2668N probably benign Het
Wdr72 G A 9: 74,059,729 (GRCm39) D392N probably benign Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Other mutations in Tmprss9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tmprss9 APN 10 80,730,262 (GRCm39) critical splice donor site probably null
IGL00990:Tmprss9 APN 10 80,728,126 (GRCm39) missense possibly damaging 0.92
IGL01710:Tmprss9 APN 10 80,733,793 (GRCm39) unclassified probably benign
IGL03075:Tmprss9 APN 10 80,719,863 (GRCm39) missense possibly damaging 0.77
IGL03132:Tmprss9 APN 10 80,730,699 (GRCm39) missense probably damaging 0.98
R0142:Tmprss9 UTSW 10 80,730,212 (GRCm39) missense possibly damaging 0.92
R0546:Tmprss9 UTSW 10 80,735,157 (GRCm39) missense probably benign 0.00
R1171:Tmprss9 UTSW 10 80,715,692 (GRCm39) missense possibly damaging 0.92
R1296:Tmprss9 UTSW 10 80,726,279 (GRCm39) missense probably benign 0.02
R1302:Tmprss9 UTSW 10 80,730,963 (GRCm39) missense probably benign 0.00
R1498:Tmprss9 UTSW 10 80,730,934 (GRCm39) missense probably benign 0.01
R1706:Tmprss9 UTSW 10 80,734,021 (GRCm39) unclassified probably benign
R1851:Tmprss9 UTSW 10 80,728,119 (GRCm39) missense probably damaging 0.98
R2096:Tmprss9 UTSW 10 80,725,268 (GRCm39) missense probably damaging 1.00
R2198:Tmprss9 UTSW 10 80,723,293 (GRCm39) missense probably damaging 1.00
R3783:Tmprss9 UTSW 10 80,723,301 (GRCm39) missense probably damaging 1.00
R5682:Tmprss9 UTSW 10 80,733,207 (GRCm39) splice site probably null
R5868:Tmprss9 UTSW 10 80,718,580 (GRCm39) missense probably benign 0.03
R6006:Tmprss9 UTSW 10 80,719,555 (GRCm39) missense possibly damaging 0.92
R6542:Tmprss9 UTSW 10 80,724,389 (GRCm39) missense probably damaging 1.00
R6676:Tmprss9 UTSW 10 80,734,145 (GRCm39) unclassified probably benign
R6718:Tmprss9 UTSW 10 80,726,198 (GRCm39) missense probably benign
R7062:Tmprss9 UTSW 10 80,730,883 (GRCm39) missense probably benign 0.00
R7316:Tmprss9 UTSW 10 80,730,813 (GRCm39) missense probably benign 0.00
R7337:Tmprss9 UTSW 10 80,718,504 (GRCm39) missense probably benign 0.00
R7624:Tmprss9 UTSW 10 80,728,053 (GRCm39) missense possibly damaging 0.77
R7659:Tmprss9 UTSW 10 80,728,843 (GRCm39) missense probably damaging 0.97
R7770:Tmprss9 UTSW 10 80,733,903 (GRCm39) splice site probably null
R7810:Tmprss9 UTSW 10 80,733,145 (GRCm39) missense unknown
R8177:Tmprss9 UTSW 10 80,730,882 (GRCm39) missense probably benign 0.00
R8324:Tmprss9 UTSW 10 80,733,205 (GRCm39) critical splice donor site probably null
R8354:Tmprss9 UTSW 10 80,723,320 (GRCm39) missense probably benign 0.04
R8454:Tmprss9 UTSW 10 80,723,320 (GRCm39) missense probably benign 0.04
R8456:Tmprss9 UTSW 10 80,730,251 (GRCm39) missense possibly damaging 0.92
R8729:Tmprss9 UTSW 10 80,726,177 (GRCm39) missense probably benign 0.01
R9010:Tmprss9 UTSW 10 80,733,701 (GRCm39) missense unknown
R9336:Tmprss9 UTSW 10 80,730,787 (GRCm39) missense probably benign 0.02
R9529:Tmprss9 UTSW 10 80,730,640 (GRCm39) missense probably damaging 0.99
R9786:Tmprss9 UTSW 10 80,734,042 (GRCm39) missense unknown
R9789:Tmprss9 UTSW 10 80,730,993 (GRCm39) missense probably benign 0.00
X0062:Tmprss9 UTSW 10 80,719,772 (GRCm39) splice site probably null
X0066:Tmprss9 UTSW 10 80,729,064 (GRCm39) missense probably damaging 0.99
Z1176:Tmprss9 UTSW 10 80,724,256 (GRCm39) missense probably damaging 0.98
Z1177:Tmprss9 UTSW 10 80,723,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAAAGGTCCTGGGTTC -3'
(R):5'- TGTGACCTTCGGCAGATTCC -3'

Sequencing Primer
(F):5'- CCTTTTATCAGCATCAGAGAGGCAG -3'
(R):5'- TGGAACTCACTCTGTAGACCG -3'
Posted On 2021-10-11