Incidental Mutation 'R8968:Fmnl1'
ID 682875
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R8968 (G1)
Quality Score 217.468
Status Not validated
Chromosome 11
Chromosomal Location 103171107-103198901 bp(+) (GRCm38)
Type of Mutation small deletion (2 aa in frame mutation)
DNA Base Change (assembly) AGGCTCTGG to AGG at 103186618 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042286] [ENSMUST00000107027] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect probably benign
Transcript: ENSMUST00000042286
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107027
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218163
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,332,310 L1153* probably null Het
2410089E03Rik A T 15: 8,201,281 H1014L possibly damaging Het
2810474O19Rik T A 6: 149,327,166 V570D probably damaging Het
Adamts2 T C 11: 50,792,723 I944T possibly damaging Het
Aqp9 A T 9: 71,138,203 C67* probably null Het
Armt1 G T 10: 4,454,150 G412W probably damaging Het
B4galt1 T C 4: 40,807,243 D381G probably benign Het
Bmp5 A T 9: 75,873,297 H292L probably benign Het
Brpf1 T C 6: 113,322,549 F1181S probably damaging Het
Btbd7 C A 12: 102,812,766 G414C probably damaging Het
Ccdc65 A T 15: 98,718,842 K204* probably null Het
Cdk5 T A 5: 24,422,381 K88M probably damaging Het
Cdrt4 T A 11: 62,992,808 L112Q probably damaging Het
Cenpb T C 2: 131,178,627 E417G unknown Het
Cep135 T C 5: 76,606,729 I351T possibly damaging Het
Ces1d A T 8: 93,187,755 S226R probably damaging Het
Cfap97 T A 8: 46,170,077 V168E possibly damaging Het
CN725425 T C 15: 91,245,887 C318R possibly damaging Het
Cnga3 T A 1: 37,261,379 D393E probably benign Het
Cpsf1 G A 15: 76,601,969 R358* probably null Het
Cyp2b23 G A 7: 26,679,538 P167L probably damaging Het
Cyp2c70 A T 19: 40,153,615 H477Q probably benign Het
D930020B18Rik A C 10: 121,654,816 Y107S probably damaging Het
Dhrs1 A T 14: 55,740,735 F216I probably benign Het
Dmgdh A T 13: 93,709,259 K474* probably null Het
Dsp T C 13: 38,151,620 I11T possibly damaging Het
Erh G T 12: 80,637,508 A65E probably benign Het
Grid2 A C 6: 64,666,155 H967P probably benign Het
Hc A G 2: 35,032,305 I503T possibly damaging Het
Herc3 T C 6: 58,890,198 L824S probably damaging Het
Hfm1 T C 5: 106,917,573 D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hspa1l A G 17: 34,977,254 K90E possibly damaging Het
Impa2 G A 18: 67,318,427 V264I probably benign Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Klhl38 C T 15: 58,322,104 V410I probably benign Het
Lcn4 A G 2: 26,668,348 I175T possibly damaging Het
Lipo2 C A 19: 33,749,517 W40L probably damaging Het
Mgam A T 6: 40,757,811 probably null Het
Myo16 T A 8: 10,569,700 I1417N unknown Het
Olfr1052 G A 2: 86,298,182 R122H probably benign Het
Olfr1196 T A 2: 88,700,793 I179F probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr603 A T 7: 103,383,460 C181S probably damaging Het
Pcdha11 A G 18: 37,012,254 N466S probably damaging Het
Pif1 C T 9: 65,591,794 T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Pole T C 5: 110,312,083 S1118P possibly damaging Het
Ppp4r4 T C 12: 103,600,447 M652T probably benign Het
Prex2 A T 1: 11,110,338 K376* probably null Het
Prps1l1 A T 12: 34,985,206 I107F probably damaging Het
Rfc1 C T 5: 65,275,435 V761I probably benign Het
Ripk4 T C 16: 97,746,003 E353G probably benign Het
Robo2 C A 16: 73,971,053 probably null Het
Rrm1 C T 7: 102,468,338 A745V probably benign Het
Sash1 A T 10: 8,730,415 V737D probably benign Het
Sel1l2 T C 2: 140,285,289 K101E probably benign Het
Selenbp2 A T 3: 94,700,030 I253F probably benign Het
Setd1a C T 7: 127,786,107 P662L possibly damaging Het
Slc16a6 C T 11: 109,454,950 V496I possibly damaging Het
Slc4a4 A T 5: 89,084,653 M239L probably benign Het
Slc7a8 G C 14: 54,781,293 A12G probably benign Het
Snx30 T C 4: 59,886,517 S309P possibly damaging Het
Spen T C 4: 141,470,390 N3389S probably benign Het
Spg11 T C 2: 122,092,206 T921A probably damaging Het
Tanc2 T A 11: 105,867,574 D720E possibly damaging Het
Tmprss9 A T 10: 80,894,329 I688F possibly damaging Het
Trap1 A G 16: 4,044,626 V596A possibly damaging Het
Ttc32 G T 12: 9,030,187 R44L probably benign Het
Tusc3 T A 8: 39,130,744 N288K probably benign Het
Ush2a G A 1: 188,395,759 G656E probably damaging Het
Vill T C 9: 119,063,603 probably null Het
Vmn1r5 A T 6: 56,986,197 R286* probably null Het
Vmn2r14 T C 5: 109,217,667 T514A probably benign Het
Vmn2r32 G A 7: 7,474,205 H396Y probably benign Het
Vmn2r75 A T 7: 86,171,557 Y56* probably null Het
Wdfy3 C T 5: 101,864,117 S2668N probably benign Het
Wdr72 G A 9: 74,152,447 D392N probably benign Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
archetypal UTSW 11 103186627 missense probably damaging 1.00
contractual UTSW 11 103180915 missense probably damaging 1.00
stylistic UTSW 11 103193736 critical splice donor site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103198173 missense unknown
R7862:Fmnl1 UTSW 11 103180930 missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103171158 start gained probably benign
R8177:Fmnl1 UTSW 11 103189959 missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103186699 missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103186614 missense possibly damaging 0.88
R8507:Fmnl1 UTSW 11 103194033 missense unknown
R8921:Fmnl1 UTSW 11 103197141 missense unknown
R8946:Fmnl1 UTSW 11 103180915 missense probably damaging 1.00
R9114:Fmnl1 UTSW 11 103196501 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTGTTATGAACCACCCAGCC -3'
(R):5'- GTCTCCACATGCCCTATCAG -3'

Sequencing Primer
(F):5'- CCTGTGTCAATGAGATCGCTCTAAG -3'
(R):5'- AGGCTACAATTTCTGGCAGC -3'
Posted On 2021-10-11