Incidental Mutation 'R8968:Ttc32'
ID 682878
Institutional Source Beutler Lab
Gene Symbol Ttc32
Ensembl Gene ENSMUSG00000066637
Gene Name tetratricopeptide repeat domain 32
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8968 (G1)
Quality Score 135.008
Status Not validated
Chromosome 12
Chromosomal Location 9029997-9041988 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 9030187 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 44 (R44L)
Ref Sequence ENSEMBL: ENSMUSP00000082891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085741] [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000219470] [ENSMUST00000219488]
AlphaFold Q9DAC7
Predicted Effect probably benign
Transcript: ENSMUST00000085741
AA Change: R44L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082891
Gene: ENSMUSG00000066637
AA Change: R44L

DomainStartEndE-ValueType
Pfam:TPR_9 12 58 1.2e-2 PFAM
Pfam:TPR_12 51 121 1e-9 PFAM
Pfam:TPR_11 53 120 1.2e-14 PFAM
Pfam:TPR_1 55 88 3.5e-6 PFAM
Pfam:TPR_9 70 134 4.9e-7 PFAM
Pfam:TPR_1 90 122 1e-10 PFAM
Pfam:TPR_2 91 122 8.3e-11 PFAM
Pfam:TPR_8 91 122 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085745
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219470
AA Change: R44L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000219488
AA Change: R44L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,332,310 L1153* probably null Het
2410089E03Rik A T 15: 8,201,281 H1014L possibly damaging Het
2810474O19Rik T A 6: 149,327,166 V570D probably damaging Het
Adamts2 T C 11: 50,792,723 I944T possibly damaging Het
Aqp9 A T 9: 71,138,203 C67* probably null Het
Armt1 G T 10: 4,454,150 G412W probably damaging Het
B4galt1 T C 4: 40,807,243 D381G probably benign Het
Bmp5 A T 9: 75,873,297 H292L probably benign Het
Brpf1 T C 6: 113,322,549 F1181S probably damaging Het
Btbd7 C A 12: 102,812,766 G414C probably damaging Het
Ccdc65 A T 15: 98,718,842 K204* probably null Het
Cdk5 T A 5: 24,422,381 K88M probably damaging Het
Cdrt4 T A 11: 62,992,808 L112Q probably damaging Het
Cenpb T C 2: 131,178,627 E417G unknown Het
Cep135 T C 5: 76,606,729 I351T possibly damaging Het
Ces1d A T 8: 93,187,755 S226R probably damaging Het
Cfap97 T A 8: 46,170,077 V168E possibly damaging Het
CN725425 T C 15: 91,245,887 C318R possibly damaging Het
Cnga3 T A 1: 37,261,379 D393E probably benign Het
Cpsf1 G A 15: 76,601,969 R358* probably null Het
Cyp2b23 G A 7: 26,679,538 P167L probably damaging Het
Cyp2c70 A T 19: 40,153,615 H477Q probably benign Het
D930020B18Rik A C 10: 121,654,816 Y107S probably damaging Het
Dhrs1 A T 14: 55,740,735 F216I probably benign Het
Dmgdh A T 13: 93,709,259 K474* probably null Het
Dsp T C 13: 38,151,620 I11T possibly damaging Het
Erh G T 12: 80,637,508 A65E probably benign Het
Fmnl1 AGGCTCTGG AGG 11: 103,186,618 probably benign Het
Grid2 A C 6: 64,666,155 H967P probably benign Het
Hc A G 2: 35,032,305 I503T possibly damaging Het
Herc3 T C 6: 58,890,198 L824S probably damaging Het
Hfm1 T C 5: 106,917,573 D80G probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hspa1l A G 17: 34,977,254 K90E possibly damaging Het
Impa2 G A 18: 67,318,427 V264I probably benign Het
Ipmk C T 10: 71,363,503 R65W probably damaging Het
Klhl38 C T 15: 58,322,104 V410I probably benign Het
Lcn4 A G 2: 26,668,348 I175T possibly damaging Het
Lipo2 C A 19: 33,749,517 W40L probably damaging Het
Mgam A T 6: 40,757,811 probably null Het
Myo16 T A 8: 10,569,700 I1417N unknown Het
Olfr1052 G A 2: 86,298,182 R122H probably benign Het
Olfr1196 T A 2: 88,700,793 I179F probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr603 A T 7: 103,383,460 C181S probably damaging Het
Pcdha11 A G 18: 37,012,254 N466S probably damaging Het
Pif1 C T 9: 65,591,794 T432M probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Pole T C 5: 110,312,083 S1118P possibly damaging Het
Ppp4r4 T C 12: 103,600,447 M652T probably benign Het
Prex2 A T 1: 11,110,338 K376* probably null Het
Prps1l1 A T 12: 34,985,206 I107F probably damaging Het
Rfc1 C T 5: 65,275,435 V761I probably benign Het
Ripk4 T C 16: 97,746,003 E353G probably benign Het
Robo2 C A 16: 73,971,053 probably null Het
Rrm1 C T 7: 102,468,338 A745V probably benign Het
Sash1 A T 10: 8,730,415 V737D probably benign Het
Sel1l2 T C 2: 140,285,289 K101E probably benign Het
Selenbp2 A T 3: 94,700,030 I253F probably benign Het
Setd1a C T 7: 127,786,107 P662L possibly damaging Het
Slc16a6 C T 11: 109,454,950 V496I possibly damaging Het
Slc4a4 A T 5: 89,084,653 M239L probably benign Het
Slc7a8 G C 14: 54,781,293 A12G probably benign Het
Snx30 T C 4: 59,886,517 S309P possibly damaging Het
Spen T C 4: 141,470,390 N3389S probably benign Het
Spg11 T C 2: 122,092,206 T921A probably damaging Het
Tanc2 T A 11: 105,867,574 D720E possibly damaging Het
Tmprss9 A T 10: 80,894,329 I688F possibly damaging Het
Trap1 A G 16: 4,044,626 V596A possibly damaging Het
Tusc3 T A 8: 39,130,744 N288K probably benign Het
Ush2a G A 1: 188,395,759 G656E probably damaging Het
Vill T C 9: 119,063,603 probably null Het
Vmn1r5 A T 6: 56,986,197 R286* probably null Het
Vmn2r14 T C 5: 109,217,667 T514A probably benign Het
Vmn2r32 G A 7: 7,474,205 H396Y probably benign Het
Vmn2r75 A T 7: 86,171,557 Y56* probably null Het
Wdfy3 C T 5: 101,864,117 S2668N probably benign Het
Wdr72 G A 9: 74,152,447 D392N probably benign Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Other mutations in Ttc32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Ttc32 APN 12 9034953 missense probably damaging 1.00
IGL02809:Ttc32 APN 12 9035879 missense possibly damaging 0.53
R0012:Ttc32 UTSW 12 9035897 missense possibly damaging 0.96
R1769:Ttc32 UTSW 12 9035073 missense possibly damaging 0.85
R5888:Ttc32 UTSW 12 9035870 missense possibly damaging 0.53
R7787:Ttc32 UTSW 12 9038083 missense probably benign 0.00
R8061:Ttc32 UTSW 12 9034953 missense probably damaging 1.00
R8884:Ttc32 UTSW 12 9038083 missense probably benign 0.00
Z1176:Ttc32 UTSW 12 9035089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTAGCCAACGAAGTCCCGTG -3'
(R):5'- TTCGCGTCCGGAACACAAAG -3'

Sequencing Primer
(F):5'- TAGCTGTGGTTCCGCTTCC -3'
(R):5'- ACACAAAGGCGTCGCTGTG -3'
Posted On 2021-10-11