Incidental Mutation 'R0131:Fcgbpl1'
ID 68289
Institutional Source Beutler Lab
Gene Symbol Fcgbpl1
Ensembl Gene ENSMUSG00000078776
Gene Name Fc fragment of IgG binding protein like 1
Synonyms 9530053A07Rik
MMRRC Submission 038416-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R0131 (G1)
Quality Score 162
Status Validated
Chromosome 7
Chromosomal Location 27828891-27864236 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27837040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 320 (R320G)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect probably damaging
Transcript: ENSMUST00000059886
AA Change: R320G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: R320G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130693
Predicted Effect probably damaging
Transcript: ENSMUST00000150948
AA Change: R320G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: R320G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Meta Mutation Damage Score 0.4767 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 87,258,197 (GRCm39) I773T probably benign Het
Adamtsl1 T A 4: 86,260,960 (GRCm39) I1057N possibly damaging Het
Anxa5 G A 3: 36,504,821 (GRCm39) A247V probably damaging Het
Ascc3 T G 10: 50,611,425 (GRCm39) W1589G probably damaging Het
Atp2b2 G A 6: 113,770,743 (GRCm39) P389S probably damaging Het
Bpifa6 T A 2: 153,824,851 (GRCm39) S9T probably benign Het
Cfhr4 T A 1: 139,682,009 (GRCm39) T196S probably damaging Het
Chd8 A G 14: 52,442,783 (GRCm39) V589A probably benign Het
Chrnb2 T C 3: 89,671,713 (GRCm39) M1V probably null Het
Col16a1 T A 4: 129,960,889 (GRCm39) V449E unknown Het
Cttnbp2nl T G 3: 104,913,173 (GRCm39) K237T probably damaging Het
Dazap1 T G 10: 80,114,060 (GRCm39) probably null Het
Fam187b T A 7: 30,688,545 (GRCm39) V22E probably damaging Het
Fat2 A T 11: 55,164,037 (GRCm39) S3073T probably benign Het
Gm16069 T C 3: 89,088,232 (GRCm39) probably benign Het
H2-T24 T A 17: 36,325,878 (GRCm39) I238F probably damaging Het
Hectd4 A G 5: 121,471,087 (GRCm39) E2658G probably benign Het
Herc1 A C 9: 66,388,192 (GRCm39) I3826L probably benign Het
Hinfp A G 9: 44,211,060 (GRCm39) C67R probably damaging Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Hspg2 T C 4: 137,279,198 (GRCm39) Y3094H probably damaging Het
Htr1f A G 16: 64,747,091 (GRCm39) V67A probably damaging Het
Iqcc T G 4: 129,510,392 (GRCm39) E374D probably damaging Het
Kcnj9 T C 1: 172,153,765 (GRCm39) T120A probably damaging Het
Kif3a A G 11: 53,477,743 (GRCm39) K404R possibly damaging Het
Kitl C T 10: 99,923,226 (GRCm39) P208S probably benign Het
Lpcat4 A G 2: 112,077,093 (GRCm39) Y479C probably damaging Het
Lrrc74b T C 16: 17,371,016 (GRCm39) N227S probably damaging Het
Mdc1 T A 17: 36,163,473 (GRCm39) V1007D probably damaging Het
Mocos T G 18: 24,812,819 (GRCm39) I571S probably benign Het
Myh8 A G 11: 67,183,014 (GRCm39) N659D probably damaging Het
Naip2 A G 13: 100,320,296 (GRCm39) V240A probably benign Het
Nap1l1 T C 10: 111,321,370 (GRCm39) S37P probably benign Het
Nin T G 12: 70,097,915 (GRCm39) K515T probably damaging Het
Npl T A 1: 153,384,864 (GRCm39) K258* probably null Het
Ntn4 T A 10: 93,480,569 (GRCm39) S98T possibly damaging Het
Or10x1 T C 1: 174,197,152 (GRCm39) V223A probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5k14 C A 16: 58,693,269 (GRCm39) M81I probably benign Het
Or8u10 T C 2: 85,915,844 (GRCm39) I92M probably damaging Het
Pkp2 T C 16: 16,058,577 (GRCm39) probably benign Het
Ppox C A 1: 171,106,849 (GRCm39) A192S possibly damaging Het
Prkdc T C 16: 15,531,517 (GRCm39) L1380S probably benign Het
Psd4 C A 2: 24,295,363 (GRCm39) A839E probably damaging Het
Ptprn2 T G 12: 116,685,711 (GRCm39) F57V probably damaging Het
Ptprt C T 2: 162,120,030 (GRCm39) V146I probably benign Het
R3hdm2 T A 10: 127,334,322 (GRCm39) M915K probably damaging Het
Rab26 C T 17: 24,749,759 (GRCm39) probably null Het
Rnf213 A G 11: 119,321,187 (GRCm39) E1215G probably benign Het
Rprd2 T C 3: 95,681,673 (GRCm39) K407E probably damaging Het
Siah3 G A 14: 75,693,574 (GRCm39) V27I possibly damaging Het
Slc14a2 T A 18: 78,235,338 (GRCm39) N280Y probably damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc25a35 A G 11: 68,862,786 (GRCm39) Y247C probably damaging Het
Slc29a4 A G 5: 142,691,285 (GRCm39) D55G probably benign Het
Slc35d1 C T 4: 103,065,378 (GRCm39) V189I probably benign Het
Srrm1 G A 4: 135,067,884 (GRCm39) R322* probably null Het
Stac3 A T 10: 127,339,519 (GRCm39) R138S probably damaging Het
Tbc1d9b T C 11: 50,026,751 (GRCm39) I73T probably benign Het
Tgtp1 A G 11: 48,878,159 (GRCm39) F182S probably benign Het
Tmcc3 T C 10: 94,381,437 (GRCm39) probably benign Het
Tmem116 A G 5: 121,631,845 (GRCm39) probably benign Het
Tmem260 T A 14: 48,720,779 (GRCm39) C306* probably null Het
Tspyl1 A G 10: 34,159,085 (GRCm39) N270S probably damaging Het
Tusc1 A T 4: 93,223,070 (GRCm39) H196Q probably benign Het
Ugt2a1 T A 5: 87,622,720 (GRCm39) K293* probably null Het
Vmn2r102 A C 17: 19,899,025 (GRCm39) T456P probably benign Het
Vmn2r90 T A 17: 17,932,511 (GRCm39) S139R probably benign Het
Zfp879 C A 11: 50,724,426 (GRCm39) G210V probably damaging Het
Zmym2 A G 14: 57,180,715 (GRCm39) N876D probably benign Het
Other mutations in Fcgbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fcgbpl1 APN 7 27,863,953 (GRCm39) missense probably damaging 1.00
IGL00757:Fcgbpl1 APN 7 27,853,870 (GRCm39) missense probably damaging 1.00
IGL01015:Fcgbpl1 APN 7 27,854,743 (GRCm39) missense probably damaging 1.00
IGL01079:Fcgbpl1 APN 7 27,839,203 (GRCm39) missense probably damaging 0.99
IGL01343:Fcgbpl1 APN 7 27,850,127 (GRCm39) missense probably benign 0.19
IGL01420:Fcgbpl1 APN 7 27,839,558 (GRCm39) missense probably benign 0.28
IGL01604:Fcgbpl1 APN 7 27,854,749 (GRCm39) missense probably benign 0.11
IGL01666:Fcgbpl1 APN 7 27,852,717 (GRCm39) missense probably damaging 1.00
IGL02002:Fcgbpl1 APN 7 27,852,221 (GRCm39) missense probably damaging 1.00
IGL02036:Fcgbpl1 APN 7 27,836,950 (GRCm39) missense possibly damaging 0.82
IGL02126:Fcgbpl1 APN 7 27,839,281 (GRCm39) missense probably damaging 1.00
IGL02150:Fcgbpl1 APN 7 27,846,204 (GRCm39) nonsense probably null
IGL02219:Fcgbpl1 APN 7 27,854,060 (GRCm39) missense probably damaging 1.00
IGL02563:Fcgbpl1 APN 7 27,857,317 (GRCm39) missense probably benign
IGL02804:Fcgbpl1 APN 7 27,852,795 (GRCm39) missense probably benign 0.00
IGL02830:Fcgbpl1 APN 7 27,862,348 (GRCm39) missense probably damaging 1.00
IGL02943:Fcgbpl1 APN 7 27,846,613 (GRCm39) missense probably damaging 1.00
IGL02977:Fcgbpl1 APN 7 27,863,797 (GRCm39) missense possibly damaging 0.83
IGL03231:Fcgbpl1 APN 7 27,853,147 (GRCm39) missense possibly damaging 0.95
IGL03304:Fcgbpl1 APN 7 27,841,667 (GRCm39) missense probably damaging 0.99
herz UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
pulse UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
Sinusoidal UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
PIT4378001:Fcgbpl1 UTSW 7 27,853,889 (GRCm39) missense possibly damaging 0.61
R0023:Fcgbpl1 UTSW 7 27,852,837 (GRCm39) missense probably benign 0.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0132:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0158:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R0230:Fcgbpl1 UTSW 7 27,856,250 (GRCm39) missense probably damaging 1.00
R0310:Fcgbpl1 UTSW 7 27,841,699 (GRCm39) missense probably benign 0.04
R0448:Fcgbpl1 UTSW 7 27,839,660 (GRCm39) missense probably benign 0.03
R0462:Fcgbpl1 UTSW 7 27,836,765 (GRCm39) missense probably damaging 1.00
R0481:Fcgbpl1 UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
R0497:Fcgbpl1 UTSW 7 27,846,890 (GRCm39) missense probably damaging 1.00
R0556:Fcgbpl1 UTSW 7 27,858,803 (GRCm39) missense probably benign
R0562:Fcgbpl1 UTSW 7 27,862,115 (GRCm39) missense probably benign 0.30
R0586:Fcgbpl1 UTSW 7 27,836,516 (GRCm39) missense probably damaging 0.99
R0924:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R0930:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R1103:Fcgbpl1 UTSW 7 27,853,945 (GRCm39) missense probably damaging 1.00
R1213:Fcgbpl1 UTSW 7 27,857,098 (GRCm39) missense probably damaging 1.00
R1292:Fcgbpl1 UTSW 7 27,842,219 (GRCm39) splice site probably benign
R1368:Fcgbpl1 UTSW 7 27,858,903 (GRCm39) missense possibly damaging 0.89
R1451:Fcgbpl1 UTSW 7 27,836,582 (GRCm39) missense probably damaging 1.00
R1477:Fcgbpl1 UTSW 7 27,856,518 (GRCm39) missense probably benign 0.01
R1538:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R1655:Fcgbpl1 UTSW 7 27,846,535 (GRCm39) missense probably damaging 0.98
R1697:Fcgbpl1 UTSW 7 27,853,772 (GRCm39) missense probably damaging 1.00
R1741:Fcgbpl1 UTSW 7 27,857,279 (GRCm39) missense probably damaging 0.98
R1796:Fcgbpl1 UTSW 7 27,854,797 (GRCm39) missense probably damaging 1.00
R1853:Fcgbpl1 UTSW 7 27,854,971 (GRCm39) nonsense probably null
R1861:Fcgbpl1 UTSW 7 27,854,157 (GRCm39) missense probably damaging 1.00
R1909:Fcgbpl1 UTSW 7 27,843,773 (GRCm39) missense possibly damaging 0.52
R1971:Fcgbpl1 UTSW 7 27,830,937 (GRCm39) missense possibly damaging 0.90
R1990:Fcgbpl1 UTSW 7 27,853,785 (GRCm39) missense probably damaging 0.98
R2020:Fcgbpl1 UTSW 7 27,855,019 (GRCm39) missense probably benign
R2084:Fcgbpl1 UTSW 7 27,856,960 (GRCm39) missense probably damaging 1.00
R2125:Fcgbpl1 UTSW 7 27,857,447 (GRCm39) missense probably benign 0.00
R2132:Fcgbpl1 UTSW 7 27,854,899 (GRCm39) missense probably damaging 1.00
R2513:Fcgbpl1 UTSW 7 27,831,060 (GRCm39) missense probably damaging 0.99
R2913:Fcgbpl1 UTSW 7 27,863,732 (GRCm39) missense probably damaging 1.00
R3150:Fcgbpl1 UTSW 7 27,853,620 (GRCm39) missense probably benign 0.21
R3499:Fcgbpl1 UTSW 7 27,853,980 (GRCm39) missense probably benign 0.42
R3702:Fcgbpl1 UTSW 7 27,857,203 (GRCm39) missense probably damaging 1.00
R3881:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R3938:Fcgbpl1 UTSW 7 27,853,719 (GRCm39) missense probably damaging 1.00
R4050:Fcgbpl1 UTSW 7 27,852,410 (GRCm39) missense possibly damaging 0.55
R4152:Fcgbpl1 UTSW 7 27,856,322 (GRCm39) missense possibly damaging 0.47
R4168:Fcgbpl1 UTSW 7 27,836,534 (GRCm39) missense probably benign 0.05
R4235:Fcgbpl1 UTSW 7 27,856,073 (GRCm39) missense probably damaging 0.99
R4241:Fcgbpl1 UTSW 7 27,853,760 (GRCm39) missense probably damaging 1.00
R4363:Fcgbpl1 UTSW 7 27,846,331 (GRCm39) missense probably damaging 1.00
R4460:Fcgbpl1 UTSW 7 27,852,281 (GRCm39) missense probably benign 0.17
R4463:Fcgbpl1 UTSW 7 27,850,144 (GRCm39) missense probably benign
R4841:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4842:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4876:Fcgbpl1 UTSW 7 27,842,225 (GRCm39) intron probably benign
R4905:Fcgbpl1 UTSW 7 27,856,408 (GRCm39) missense possibly damaging 0.93
R4997:Fcgbpl1 UTSW 7 27,843,349 (GRCm39) missense possibly damaging 0.77
R5091:Fcgbpl1 UTSW 7 27,856,383 (GRCm39) missense probably benign 0.44
R5159:Fcgbpl1 UTSW 7 27,852,733 (GRCm39) missense probably benign 0.09
R5326:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5396:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign
R5441:Fcgbpl1 UTSW 7 27,856,339 (GRCm39) missense probably damaging 1.00
R5480:Fcgbpl1 UTSW 7 27,857,424 (GRCm39) nonsense probably null
R5542:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5571:Fcgbpl1 UTSW 7 27,855,994 (GRCm39) missense probably damaging 0.99
R5613:Fcgbpl1 UTSW 7 27,842,303 (GRCm39) intron probably benign
R5637:Fcgbpl1 UTSW 7 27,852,277 (GRCm39) missense probably benign 0.00
R5766:Fcgbpl1 UTSW 7 27,836,754 (GRCm39) nonsense probably null
R6174:Fcgbpl1 UTSW 7 27,839,384 (GRCm39) missense probably damaging 0.96
R6233:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R6250:Fcgbpl1 UTSW 7 27,850,139 (GRCm39) missense probably damaging 1.00
R6379:Fcgbpl1 UTSW 7 27,857,017 (GRCm39) missense probably damaging 1.00
R6442:Fcgbpl1 UTSW 7 27,843,611 (GRCm39) missense possibly damaging 0.88
R6478:Fcgbpl1 UTSW 7 27,854,798 (GRCm39) missense probably damaging 1.00
R6699:Fcgbpl1 UTSW 7 27,843,793 (GRCm39) missense probably damaging 1.00
R6852:Fcgbpl1 UTSW 7 27,846,560 (GRCm39) missense probably damaging 1.00
R6883:Fcgbpl1 UTSW 7 27,852,260 (GRCm39) missense possibly damaging 0.89
R6902:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6903:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6904:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6992:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign 0.04
R7023:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R7039:Fcgbpl1 UTSW 7 27,839,573 (GRCm39) missense possibly damaging 0.80
R7171:Fcgbpl1 UTSW 7 27,853,944 (GRCm39) nonsense probably null
R7282:Fcgbpl1 UTSW 7 27,843,833 (GRCm39) missense probably benign 0.02
R7291:Fcgbpl1 UTSW 7 27,839,645 (GRCm39) missense probably benign
R7344:Fcgbpl1 UTSW 7 27,852,185 (GRCm39) missense possibly damaging 0.46
R7344:Fcgbpl1 UTSW 7 27,839,704 (GRCm39) missense possibly damaging 0.79
R7392:Fcgbpl1 UTSW 7 27,863,797 (GRCm39) missense possibly damaging 0.83
R7531:Fcgbpl1 UTSW 7 27,839,656 (GRCm39) missense probably benign
R7541:Fcgbpl1 UTSW 7 27,843,681 (GRCm39) nonsense probably null
R7577:Fcgbpl1 UTSW 7 27,853,848 (GRCm39) missense possibly damaging 0.65
R7594:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R7647:Fcgbpl1 UTSW 7 27,839,470 (GRCm39) missense probably benign 0.00
R7718:Fcgbpl1 UTSW 7 27,846,626 (GRCm39) missense probably damaging 1.00
R7733:Fcgbpl1 UTSW 7 27,839,390 (GRCm39) missense probably damaging 1.00
R7737:Fcgbpl1 UTSW 7 27,856,498 (GRCm39) missense probably damaging 1.00
R7908:Fcgbpl1 UTSW 7 27,846,921 (GRCm39) missense probably benign 0.12
R8013:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8014:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8151:Fcgbpl1 UTSW 7 27,852,766 (GRCm39) missense possibly damaging 0.95
R8175:Fcgbpl1 UTSW 7 27,863,873 (GRCm39) nonsense probably null
R8254:Fcgbpl1 UTSW 7 27,846,774 (GRCm39) missense possibly damaging 0.63
R8345:Fcgbpl1 UTSW 7 27,854,785 (GRCm39) missense probably damaging 1.00
R8414:Fcgbpl1 UTSW 7 27,842,158 (GRCm39) missense probably damaging 1.00
R8419:Fcgbpl1 UTSW 7 27,843,346 (GRCm39) missense probably damaging 1.00
R8496:Fcgbpl1 UTSW 7 27,843,377 (GRCm39) missense possibly damaging 0.81
R8691:Fcgbpl1 UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
R8785:Fcgbpl1 UTSW 7 27,854,132 (GRCm39) missense probably damaging 1.00
R8863:Fcgbpl1 UTSW 7 27,831,006 (GRCm39) missense probably damaging 1.00
R8926:Fcgbpl1 UTSW 7 27,853,869 (GRCm39) missense probably damaging 1.00
R8950:Fcgbpl1 UTSW 7 27,863,751 (GRCm39) missense probably benign 0.32
R9014:Fcgbpl1 UTSW 7 27,854,876 (GRCm39) missense probably damaging 1.00
R9045:Fcgbpl1 UTSW 7 27,853,856 (GRCm39) missense probably damaging 1.00
R9115:Fcgbpl1 UTSW 7 27,853,754 (GRCm39) missense possibly damaging 0.74
R9233:Fcgbpl1 UTSW 7 27,839,519 (GRCm39) missense possibly damaging 0.83
R9330:Fcgbpl1 UTSW 7 27,856,410 (GRCm39) missense probably benign 0.02
R9426:Fcgbpl1 UTSW 7 27,843,281 (GRCm39) missense possibly damaging 0.92
R9477:Fcgbpl1 UTSW 7 27,852,265 (GRCm39) missense probably damaging 1.00
R9502:Fcgbpl1 UTSW 7 27,836,891 (GRCm39) missense probably benign 0.09
R9505:Fcgbpl1 UTSW 7 27,841,909 (GRCm39) nonsense probably null
R9601:Fcgbpl1 UTSW 7 27,853,805 (GRCm39) missense possibly damaging 0.78
R9630:Fcgbpl1 UTSW 7 27,836,624 (GRCm39) missense probably damaging 1.00
R9632:Fcgbpl1 UTSW 7 27,841,726 (GRCm39) missense probably benign
R9673:Fcgbpl1 UTSW 7 27,856,044 (GRCm39) missense probably benign 0.25
R9735:Fcgbpl1 UTSW 7 27,856,435 (GRCm39) missense probably damaging 1.00
Z1176:Fcgbpl1 UTSW 7 27,854,187 (GRCm39) missense probably benign 0.03
Z1176:Fcgbpl1 UTSW 7 27,841,811 (GRCm39) missense probably benign 0.06
Z1177:Fcgbpl1 UTSW 7 27,839,323 (GRCm39) missense probably benign 0.25
Z1186:Fcgbpl1 UTSW 7 27,856,411 (GRCm39) missense probably benign 0.01
Z1186:Fcgbpl1 UTSW 7 27,846,130 (GRCm39) missense probably benign 0.00
Z1186:Fcgbpl1 UTSW 7 27,830,997 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGCCCAGCTCTTTAAGAAAGAC -3'
(R):5'- TCTTGTGGCAACCTCAATCACTGTG -3'

Sequencing Primer
(F):5'- CTTTAAGAAAGACCTTTTCTGTGGC -3'
(R):5'- AACCTCAATCACTGTGGTCTATC -3'
Posted On 2013-09-03