Incidental Mutation 'R8969:Xrn2'
ID682912
Institutional Source Beutler Lab
Gene Symbol Xrn2
Ensembl Gene ENSMUSG00000027433
Gene Name5'-3' exoribonuclease 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R8969 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location147012996-147078000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147029384 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 302 (I302T)
Ref Sequence ENSEMBL: ENSMUSP00000028921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028921]
Predicted Effect probably damaging
Transcript: ENSMUST00000028921
AA Change: I302T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: I302T

DomainStartEndE-ValueType
Pfam:XRN_N 1 254 1.5e-104 PFAM
ZnF_C2HC 262 278 7.99e-1 SMART
low complexity region 415 427 N/A INTRINSIC
PDB:3FQD|A 469 785 8e-75 PDB
low complexity region 913 932 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,277,944 N662K probably benign Het
Acp7 G A 7: 28,607,957 R492W probably damaging Het
Adam33 C T 2: 131,053,074 G688D probably damaging Het
Ak3 T G 19: 29,047,694 M46L probably benign Het
Aldh1l1 A G 6: 90,570,808 T417A probably benign Het
Ambp C T 4: 63,154,091 probably benign Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Ash1l T C 3: 88,966,291 M127T possibly damaging Het
Atg9b C T 5: 24,387,834 A524T probably benign Het
Btbd10 A T 7: 113,325,955 S277T probably damaging Het
Ccdc167 T C 17: 29,705,579 D16G probably damaging Het
Cdh12 A G 15: 21,492,653 T253A probably damaging Het
Cfap206 A T 4: 34,692,522 D501E probably benign Het
Chrnb2 A G 3: 89,757,225 F461L probably damaging Het
Clic1 T C 17: 35,055,410 probably null Het
Cmah A G 13: 24,422,653 Y89C probably damaging Het
Crkl A G 16: 17,469,054 E158G probably damaging Het
Cyp3a59 A T 5: 146,112,820 E486V probably benign Het
D16Ertd472e T G 16: 78,547,794 Y142S probably damaging Het
Decr2 T A 17: 26,087,381 M94L probably benign Het
Dspp A T 5: 104,177,774 S668C unknown Het
Dync2h1 T C 9: 7,130,723 R1708G probably damaging Het
Eno3 T A 11: 70,660,865 I217N possibly damaging Het
Fcho2 A T 13: 98,755,096 L386* probably null Het
Gm5114 C A 7: 39,409,308 V296F probably damaging Het
Hc A G 2: 35,019,463 probably null Het
Helz2 A G 2: 181,237,788 V679A probably benign Het
Ifnar2 T C 16: 91,404,172 F434L probably benign Het
Isl1 A G 13: 116,303,321 S164P possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kat2b T A 17: 53,660,088 Y621* probably null Het
Kif2b T C 11: 91,577,193 H88R probably benign Het
Kit G A 5: 75,639,062 V485I Het
Klhl36 T C 8: 119,870,148 L196P probably damaging Het
Klk1b27 T A 7: 44,054,508 I25K probably damaging Het
Kmt2c T A 5: 25,314,389 Q2241L possibly damaging Het
Krt10 T A 11: 99,387,608 N242Y probably damaging Het
Krt36 T A 11: 100,102,303 I449F probably damaging Het
Med27 G T 2: 29,346,863 V7F possibly damaging Het
Mxd1 C T 6: 86,651,484 V145M probably benign Het
Mylip T A 13: 45,391,344 F81L probably damaging Het
Nceh1 T A 3: 27,222,736 F69L probably null Het
Ndufs3 A T 2: 90,902,429 N104K probably damaging Het
Nfxl1 A C 5: 72,559,130 V46G unknown Het
Olfr1022 A G 2: 85,869,488 N299D probably benign Het
Olfr1111 T A 2: 87,150,584 M26L probably benign Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Olfr585 T G 7: 103,098,044 I101S probably damaging Het
Palld T A 8: 61,684,849 H624L probably damaging Het
Pcbp2 T G 15: 102,490,779 L343R probably damaging Het
Pclo T A 5: 14,522,194 I531N unknown Het
Phldb2 A T 16: 45,772,133 probably null Het
Ppp2r5e G T 12: 75,453,718 T467N possibly damaging Het
Ptcd3 T C 6: 71,903,447 I97M probably benign Het
Ptpn21 T A 12: 98,689,025 Q561L probably benign Het
Rnf38 A T 4: 44,149,079 H121Q possibly damaging Het
Rrnad1 G A 3: 87,929,975 probably benign Het
Sec1 A G 7: 45,679,473 F50S possibly damaging Het
Sec62 A G 3: 30,818,875 E369G unknown Het
Serpinb2 A T 1: 107,524,660 I323F probably damaging Het
Sh3rf1 A C 8: 61,384,826 T802P probably benign Het
Srd5a3 A G 5: 76,153,646 R241G probably benign Het
Suox T C 10: 128,671,673 N162S probably benign Het
Tenm2 C T 11: 36,051,861 C1327Y probably damaging Het
Terf2ip A G 8: 112,011,738 D86G probably damaging Het
Tmc1 G A 19: 20,816,229 R523C probably damaging Het
Tmprss11e T A 5: 86,713,899 I263L possibly damaging Het
Tnfrsf22 T A 7: 143,638,436 N171I unknown Het
Trpm3 A G 19: 22,925,944 S1035G probably damaging Het
U2af1 C T 17: 31,648,880 V72M possibly damaging Het
Uimc1 A G 13: 55,085,634 C70R possibly damaging Het
Vmn2r83 A G 10: 79,478,019 T154A probably benign Het
Zbtb6 A G 2: 37,428,665 L417P probably damaging Het
Zdhhc14 C T 17: 5,725,280 S269L probably benign Het
Zfp735 T A 11: 73,711,873 F548I possibly damaging Het
Zfp809 T C 9: 22,225,834 probably null Het
Zranb3 A T 1: 127,960,851 D832E possibly damaging Het
Other mutations in Xrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Xrn2 APN 2 147036750 missense probably benign 0.00
IGL00950:Xrn2 APN 2 147028146 nonsense probably null
IGL01323:Xrn2 APN 2 147034847 splice site probably benign
IGL01328:Xrn2 APN 2 147029930 missense possibly damaging 0.90
IGL01545:Xrn2 APN 2 147038179 missense probably benign
IGL01729:Xrn2 APN 2 147036797 critical splice donor site probably null
IGL01805:Xrn2 APN 2 147028143 missense probably damaging 0.98
IGL02326:Xrn2 APN 2 147047713 missense probably benign 0.32
IGL02332:Xrn2 APN 2 147026590 missense probably damaging 1.00
IGL02556:Xrn2 APN 2 147038296 splice site probably benign
IGL02609:Xrn2 APN 2 147050025 missense probably benign 0.00
IGL02941:Xrn2 APN 2 147026524 missense probably damaging 1.00
IGL03119:Xrn2 APN 2 147042872 missense probably damaging 1.00
R0052:Xrn2 UTSW 2 147040965 splice site probably benign
R0114:Xrn2 UTSW 2 147029779 missense probably damaging 0.98
R0196:Xrn2 UTSW 2 147047660 missense probably damaging 0.99
R0799:Xrn2 UTSW 2 147029898 missense probably benign 0.03
R0991:Xrn2 UTSW 2 147042082 missense probably benign 0.40
R1444:Xrn2 UTSW 2 147061488 missense probably damaging 0.99
R1727:Xrn2 UTSW 2 147061516 missense probably benign 0.00
R1735:Xrn2 UTSW 2 147061423 missense probably damaging 1.00
R1885:Xrn2 UTSW 2 147049361 nonsense probably null
R2199:Xrn2 UTSW 2 147024750 missense probably damaging 0.96
R2884:Xrn2 UTSW 2 147047656 missense probably damaging 1.00
R3730:Xrn2 UTSW 2 147024809 missense probably benign 0.09
R3771:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3772:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3773:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3816:Xrn2 UTSW 2 147028200 missense probably damaging 1.00
R3927:Xrn2 UTSW 2 147038189 missense probably benign
R4173:Xrn2 UTSW 2 147047692 missense probably damaging 0.96
R4659:Xrn2 UTSW 2 147061474 missense probably benign 0.01
R4928:Xrn2 UTSW 2 147051718 missense possibly damaging 0.80
R5452:Xrn2 UTSW 2 147024713 critical splice acceptor site probably null
R5527:Xrn2 UTSW 2 147029755 missense probably benign 0.02
R6297:Xrn2 UTSW 2 147026570 missense probably damaging 1.00
R6301:Xrn2 UTSW 2 147063342 missense probably benign 0.05
R6316:Xrn2 UTSW 2 147042010 missense probably damaging 1.00
R6705:Xrn2 UTSW 2 147036662 critical splice acceptor site probably null
R7173:Xrn2 UTSW 2 147042093 missense probably damaging 1.00
R7408:Xrn2 UTSW 2 147042097 critical splice donor site probably null
R7412:Xrn2 UTSW 2 147049346 missense probably damaging 0.99
R7501:Xrn2 UTSW 2 147029756 missense probably damaging 1.00
R7856:Xrn2 UTSW 2 147068473 splice site probably null
R8912:Xrn2 UTSW 2 147049993 missense probably benign 0.04
Z1177:Xrn2 UTSW 2 147028206 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACATATTCACTGCTGGCCC -3'
(R):5'- GCTCCTCTCCACATCAAATGG -3'

Sequencing Primer
(F):5'- GCTGGCCCTTCATACCAAATAATTG -3'
(R):5'- TCTCCACATCAAATGGGAATGG -3'
Posted On2021-10-11