Incidental Mutation 'R8969:Tmprss11e'
ID 682929
Institutional Source Beutler Lab
Gene Symbol Tmprss11e
Ensembl Gene ENSMUSG00000054537
Gene Name transmembrane protease, serine 11e
Synonyms DESC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8969 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 86705186-86745815 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86713899 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 263 (I263L)
Ref Sequence ENSEMBL: ENSMUSP00000124534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161306]
AlphaFold Q5S248
Predicted Effect possibly damaging
Transcript: ENSMUST00000161306
AA Change: I263L

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124534
Gene: ENSMUSG00000054537
AA Change: I263L

DomainStartEndE-ValueType
Pfam:SEA 50 153 7.6e-24 PFAM
Tryp_SPc 191 417 1.58e-86 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,277,944 N662K probably benign Het
Acp7 G A 7: 28,607,957 R492W probably damaging Het
Adam33 C T 2: 131,053,074 G688D probably damaging Het
Ak3 T G 19: 29,047,694 M46L probably benign Het
Aldh1l1 A G 6: 90,570,808 T417A probably benign Het
Ambp C T 4: 63,154,091 probably benign Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Ash1l T C 3: 88,966,291 M127T possibly damaging Het
Atg9b C T 5: 24,387,834 A524T probably benign Het
Btbd10 A T 7: 113,325,955 S277T probably damaging Het
Ccdc167 T C 17: 29,705,579 D16G probably damaging Het
Cdh12 A G 15: 21,492,653 T253A probably damaging Het
Cfap206 A T 4: 34,692,522 D501E probably benign Het
Chrnb2 A G 3: 89,757,225 F461L probably damaging Het
Clic1 T C 17: 35,055,410 probably null Het
Cmah A G 13: 24,422,653 Y89C probably damaging Het
Crkl A G 16: 17,469,054 E158G probably damaging Het
Cyp3a59 A T 5: 146,112,820 E486V probably benign Het
D16Ertd472e T G 16: 78,547,794 Y142S probably damaging Het
Decr2 T A 17: 26,087,381 M94L probably benign Het
Dspp A T 5: 104,177,774 S668C unknown Het
Dync2h1 T C 9: 7,130,723 R1708G probably damaging Het
Eno3 T A 11: 70,660,865 I217N possibly damaging Het
Fcho2 A T 13: 98,755,096 L386* probably null Het
Gm5114 C A 7: 39,409,308 V296F probably damaging Het
Hc A G 2: 35,019,463 probably null Het
Helz2 A G 2: 181,237,788 V679A probably benign Het
Ifnar2 T C 16: 91,404,172 F434L probably benign Het
Isl1 A G 13: 116,303,321 S164P possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kat2b T A 17: 53,660,088 Y621* probably null Het
Kif2b T C 11: 91,577,193 H88R probably benign Het
Kit G A 5: 75,639,062 V485I Het
Klhl36 T C 8: 119,870,148 L196P probably damaging Het
Klk1b27 T A 7: 44,054,508 I25K probably damaging Het
Kmt2c T A 5: 25,314,389 Q2241L possibly damaging Het
Krt10 T A 11: 99,387,608 N242Y probably damaging Het
Krt36 T A 11: 100,102,303 I449F probably damaging Het
Med27 G T 2: 29,346,863 V7F possibly damaging Het
Mxd1 C T 6: 86,651,484 V145M probably benign Het
Mylip T A 13: 45,391,344 F81L probably damaging Het
Nceh1 T A 3: 27,222,736 F69L probably null Het
Ndufs3 A T 2: 90,902,429 N104K probably damaging Het
Nfxl1 A C 5: 72,559,130 V46G unknown Het
Olfr1022 A G 2: 85,869,488 N299D probably benign Het
Olfr1111 T A 2: 87,150,584 M26L probably benign Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Olfr585 T G 7: 103,098,044 I101S probably damaging Het
Palld T A 8: 61,684,849 H624L probably damaging Het
Pcbp2 T G 15: 102,490,779 L343R probably damaging Het
Pclo T A 5: 14,522,194 I531N unknown Het
Phip T C 9: 82,926,964 probably benign Het
Phldb2 A T 16: 45,772,133 probably null Het
Ppp2r5e G T 12: 75,453,718 T467N possibly damaging Het
Ptcd3 T C 6: 71,903,447 I97M probably benign Het
Ptpn21 T A 12: 98,689,025 Q561L probably benign Het
Rnf38 A T 4: 44,149,079 H121Q possibly damaging Het
Rrnad1 G A 3: 87,929,975 probably benign Het
Sec1 A G 7: 45,679,473 F50S possibly damaging Het
Sec62 A G 3: 30,818,875 E369G unknown Het
Serpinb2 A T 1: 107,524,660 I323F probably damaging Het
Sh3rf1 A C 8: 61,384,826 T802P probably benign Het
Srd5a3 A G 5: 76,153,646 R241G probably benign Het
Suox T C 10: 128,671,673 N162S probably benign Het
Tenm2 C T 11: 36,051,861 C1327Y probably damaging Het
Terf2ip A G 8: 112,011,738 D86G probably damaging Het
Tmc1 G A 19: 20,816,229 R523C probably damaging Het
Tmtc4 T C 14: 122,941,812 probably benign Het
Tnfrsf22 T A 7: 143,638,436 N171I unknown Het
Trpm3 A G 19: 22,925,944 S1035G probably damaging Het
U2af1 C T 17: 31,648,880 V72M possibly damaging Het
Uimc1 A G 13: 55,085,634 C70R possibly damaging Het
Vmn2r83 A G 10: 79,478,019 T154A probably benign Het
Xrn2 T C 2: 147,029,384 I302T probably damaging Het
Zbtb6 A G 2: 37,428,665 L417P probably damaging Het
Zdhhc14 C T 17: 5,725,280 S269L probably benign Het
Zfp735 T A 11: 73,711,873 F548I possibly damaging Het
Zfp809 T C 9: 22,225,834 probably null Het
Zranb3 A T 1: 127,960,851 D832E possibly damaging Het
Other mutations in Tmprss11e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01737:Tmprss11e APN 5 86719734 missense probably damaging 1.00
IGL02111:Tmprss11e APN 5 86719801 missense possibly damaging 0.86
IGL02257:Tmprss11e APN 5 86724180 missense probably damaging 1.00
R0610:Tmprss11e UTSW 5 86707347 nonsense probably null
R1402:Tmprss11e UTSW 5 86715618 missense probably damaging 0.99
R1402:Tmprss11e UTSW 5 86715618 missense probably damaging 0.99
R1528:Tmprss11e UTSW 5 86724210 missense probably damaging 1.00
R1555:Tmprss11e UTSW 5 86715588 missense probably damaging 1.00
R2157:Tmprss11e UTSW 5 86713728 missense probably benign
R2939:Tmprss11e UTSW 5 86721407 missense probably damaging 1.00
R3743:Tmprss11e UTSW 5 86709456 nonsense probably null
R4072:Tmprss11e UTSW 5 86715643 missense possibly damaging 0.53
R4073:Tmprss11e UTSW 5 86715643 missense possibly damaging 0.53
R4074:Tmprss11e UTSW 5 86715643 missense possibly damaging 0.53
R4650:Tmprss11e UTSW 5 86727353 missense probably damaging 1.00
R5371:Tmprss11e UTSW 5 86727366 missense probably benign 0.45
R5623:Tmprss11e UTSW 5 86709456 nonsense probably null
R6793:Tmprss11e UTSW 5 86715555 missense probably damaging 1.00
R7466:Tmprss11e UTSW 5 86709480 missense probably benign 0.00
R8790:Tmprss11e UTSW 5 86707400 missense probably benign 0.00
R9571:Tmprss11e UTSW 5 86727290 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCCAAATTAGATCAACGGG -3'
(R):5'- TTCTTATACGGCTACCTGCAG -3'

Sequencing Primer
(F):5'- ACCATCATTTTTCAATGCTCCAAATC -3'
(R):5'- GGCTACCTGCAGATAAAAATCATTC -3'
Posted On 2021-10-11