Incidental Mutation 'R8969:Tmc1'
ID 682978
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Name transmembrane channel-like gene family 1
Synonyms 4933416G09Rik, Beethoven, Bth
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8969 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 20783458-20954202 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20816229 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 523 (R523C)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
AlphaFold Q8R4P5
Predicted Effect probably damaging
Transcript: ENSMUST00000039500
AA Change: R523C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: R523C

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,277,944 N662K probably benign Het
Acp7 G A 7: 28,607,957 R492W probably damaging Het
Adam33 C T 2: 131,053,074 G688D probably damaging Het
Ak3 T G 19: 29,047,694 M46L probably benign Het
Aldh1l1 A G 6: 90,570,808 T417A probably benign Het
Ambp C T 4: 63,154,091 probably benign Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Ash1l T C 3: 88,966,291 M127T possibly damaging Het
Atg9b C T 5: 24,387,834 A524T probably benign Het
Btbd10 A T 7: 113,325,955 S277T probably damaging Het
Ccdc167 T C 17: 29,705,579 D16G probably damaging Het
Cdh12 A G 15: 21,492,653 T253A probably damaging Het
Cfap206 A T 4: 34,692,522 D501E probably benign Het
Chrnb2 A G 3: 89,757,225 F461L probably damaging Het
Clic1 T C 17: 35,055,410 probably null Het
Cmah A G 13: 24,422,653 Y89C probably damaging Het
Crkl A G 16: 17,469,054 E158G probably damaging Het
Cyp3a59 A T 5: 146,112,820 E486V probably benign Het
D16Ertd472e T G 16: 78,547,794 Y142S probably damaging Het
Decr2 T A 17: 26,087,381 M94L probably benign Het
Dspp A T 5: 104,177,774 S668C unknown Het
Dync2h1 T C 9: 7,130,723 R1708G probably damaging Het
Eno3 T A 11: 70,660,865 I217N possibly damaging Het
Fcho2 A T 13: 98,755,096 L386* probably null Het
Gm5114 C A 7: 39,409,308 V296F probably damaging Het
Hc A G 2: 35,019,463 probably null Het
Helz2 A G 2: 181,237,788 V679A probably benign Het
Ifnar2 T C 16: 91,404,172 F434L probably benign Het
Isl1 A G 13: 116,303,321 S164P possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kat2b T A 17: 53,660,088 Y621* probably null Het
Kif2b T C 11: 91,577,193 H88R probably benign Het
Kit G A 5: 75,639,062 V485I Het
Klhl36 T C 8: 119,870,148 L196P probably damaging Het
Klk1b27 T A 7: 44,054,508 I25K probably damaging Het
Kmt2c T A 5: 25,314,389 Q2241L possibly damaging Het
Krt10 T A 11: 99,387,608 N242Y probably damaging Het
Krt36 T A 11: 100,102,303 I449F probably damaging Het
Med27 G T 2: 29,346,863 V7F possibly damaging Het
Mxd1 C T 6: 86,651,484 V145M probably benign Het
Mylip T A 13: 45,391,344 F81L probably damaging Het
Nceh1 T A 3: 27,222,736 F69L probably null Het
Ndufs3 A T 2: 90,902,429 N104K probably damaging Het
Nfxl1 A C 5: 72,559,130 V46G unknown Het
Olfr1022 A G 2: 85,869,488 N299D probably benign Het
Olfr1111 T A 2: 87,150,584 M26L probably benign Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Olfr585 T G 7: 103,098,044 I101S probably damaging Het
Palld T A 8: 61,684,849 H624L probably damaging Het
Pcbp2 T G 15: 102,490,779 L343R probably damaging Het
Pclo T A 5: 14,522,194 I531N unknown Het
Phip T C 9: 82,926,964 probably benign Het
Phldb2 A T 16: 45,772,133 probably null Het
Ppp2r5e G T 12: 75,453,718 T467N possibly damaging Het
Ptcd3 T C 6: 71,903,447 I97M probably benign Het
Ptpn21 T A 12: 98,689,025 Q561L probably benign Het
Rnf38 A T 4: 44,149,079 H121Q possibly damaging Het
Rrnad1 G A 3: 87,929,975 probably benign Het
Sec1 A G 7: 45,679,473 F50S possibly damaging Het
Sec62 A G 3: 30,818,875 E369G unknown Het
Serpinb2 A T 1: 107,524,660 I323F probably damaging Het
Sh3rf1 A C 8: 61,384,826 T802P probably benign Het
Srd5a3 A G 5: 76,153,646 R241G probably benign Het
Suox T C 10: 128,671,673 N162S probably benign Het
Tenm2 C T 11: 36,051,861 C1327Y probably damaging Het
Terf2ip A G 8: 112,011,738 D86G probably damaging Het
Tmprss11e T A 5: 86,713,899 I263L possibly damaging Het
Tmtc4 T C 14: 122,941,812 probably benign Het
Tnfrsf22 T A 7: 143,638,436 N171I unknown Het
Trpm3 A G 19: 22,925,944 S1035G probably damaging Het
U2af1 C T 17: 31,648,880 V72M possibly damaging Het
Uimc1 A G 13: 55,085,634 C70R possibly damaging Het
Vmn2r83 A G 10: 79,478,019 T154A probably benign Het
Xrn2 T C 2: 147,029,384 I302T probably damaging Het
Zbtb6 A G 2: 37,428,665 L417P probably damaging Het
Zdhhc14 C T 17: 5,725,280 S269L probably benign Het
Zfp735 T A 11: 73,711,873 F548I possibly damaging Het
Zfp809 T C 9: 22,225,834 probably null Het
Zranb3 A T 1: 127,960,851 D832E possibly damaging Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
dinner_bell UTSW 19 20795516 missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20824030 missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20789590 missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20827651 critical splice donor site probably null
R6796:Tmc1 UTSW 19 20799036 missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20799178 missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20907008 missense probably damaging 0.98
R7825:Tmc1 UTSW 19 20804645 missense possibly damaging 0.55
R8024:Tmc1 UTSW 19 20900817 missense probably damaging 1.00
R8073:Tmc1 UTSW 19 20868361 missense probably benign 0.08
R8786:Tmc1 UTSW 19 20826589 missense probably damaging 1.00
R8791:Tmc1 UTSW 19 20789845 missense probably benign 0.00
R8973:Tmc1 UTSW 19 20900851 missense probably benign
R9429:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
Z1176:Tmc1 UTSW 19 20826506 missense probably null 1.00
Z1177:Tmc1 UTSW 19 20795608 missense possibly damaging 0.47
Z1177:Tmc1 UTSW 19 20823982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTCACTCGTGTAACTCG -3'
(R):5'- TGGAGACAGTTTGAGAGTAACC -3'

Sequencing Primer
(F):5'- TGTAACTCGGAGGCATCCTAC -3'
(R):5'- AGACAGTTTGAGAGTAACCAAATAC -3'
Posted On 2021-10-11