Incidental Mutation 'R8970:Ankar'
ID 682982
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8970 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 72652337 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably null
Transcript: ENSMUST00000053499
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211837
Predicted Effect probably benign
Transcript: ENSMUST00000212573
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,420 E198G probably benign Het
2310007B03Rik G C 1: 93,159,811 P107A probably benign Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abca2 T C 2: 25,445,716 V2113A probably benign Het
Adam10 A G 9: 70,748,176 N309D probably benign Het
Adcy1 T A 11: 7,149,983 W698R probably benign Het
Adnp T C 2: 168,189,370 N7S possibly damaging Het
Ankrd34b T A 13: 92,439,082 I274K probably benign Het
Apela A T 8: 65,036,949 L6H unknown Het
Ash1l T C 3: 89,069,000 I2629T probably benign Het
Auts2 C T 5: 132,258,952 R64K possibly damaging Het
Bms1 A G 6: 118,392,331 V1003A possibly damaging Het
C2cd3 T C 7: 100,419,764 V555A Het
C2cd6 T A 1: 59,069,736 H252L possibly damaging Het
Capn3 G T 2: 120,464,085 K71N possibly damaging Het
Clec2l C A 6: 38,680,187 T195K possibly damaging Het
Col27a1 T C 4: 63,215,868 S15P unknown Het
Coro2b T C 9: 62,426,527 probably benign Het
Crocc2 A T 1: 93,188,965 T233S probably benign Het
Ddb1 A G 19: 10,608,444 Q174R probably benign Het
Denr C T 5: 123,917,216 P48L probably damaging Het
Dusp26 A G 8: 31,094,204 Y113C probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Evi5l A G 8: 4,186,154 probably benign Het
Fam60a A T 6: 148,933,126 F2I probably damaging Het
Fgf2 G T 3: 37,404,618 V96F probably benign Het
Gm3139 T C 5: 94,537,786 V435A probably benign Het
Gpr139 A G 7: 119,144,811 Y184H probably damaging Het
Gtf3c1 A C 7: 125,673,055 probably benign Het
Gucy1b2 A G 14: 62,419,215 V231A possibly damaging Het
Gucy2g T C 19: 55,203,046 E991G possibly damaging Het
Gvin1 A T 7: 106,163,440 H607Q probably damaging Het
Hal T C 10: 93,489,174 V15A probably damaging Het
Hes3 A G 4: 152,291,579 probably null Het
Il11 A G 7: 4,776,182 L72P probably damaging Het
Iqsec3 T A 6: 121,389,569 I785F probably damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Lrpprc T A 17: 84,767,055 T475S probably damaging Het
Lrrc63 T A 14: 75,125,191 T300S unknown Het
Lsamp A T 16: 42,174,165 I331F possibly damaging Het
Ltn1 A T 16: 87,416,038 I545K probably benign Het
Med13l G A 5: 118,745,099 R1341H probably damaging Het
Msh4 T A 3: 153,869,732 K669* probably null Het
Myo10 T A 15: 25,803,381 L1558H possibly damaging Het
Ncbp1 G A 4: 46,170,023 V699M probably damaging Het
Olfr1451 T A 19: 12,998,989 M1K probably null Het
Olfr1468-ps1 T G 19: 13,375,753 S264A unknown Het
Olfr361 T A 2: 37,085,466 Y94F probably benign Het
Olfr504 A G 7: 108,565,790 S2P probably benign Het
Parpbp G A 10: 88,126,324 R165W probably damaging Het
Pcdhgb7 T A 18: 37,752,578 M267K probably benign Het
Pitx3 T A 19: 46,137,101 H68L possibly damaging Het
Ppfia4 A G 1: 134,324,551 L395P probably damaging Het
Ptprh T C 7: 4,580,945 D216G possibly damaging Het
Ptprs A G 17: 56,423,353 S1174P possibly damaging Het
Shf A G 2: 122,357,173 S51P probably benign Het
Slc19a3 A T 1: 83,023,101 L65Q probably damaging Het
Srgap2 G A 1: 131,298,366 L390F Het
Srpk1 T C 17: 28,599,519 T448A probably benign Het
Stat5a A G 11: 100,880,527 D612G probably benign Het
Supt4a A T 11: 87,742,819 E67V probably benign Het
Tango6 T A 8: 106,689,239 C231S probably damaging Het
Th A G 7: 142,893,059 L490P probably damaging Het
Tpcn1 C T 5: 120,544,453 G497S probably damaging Het
Trim10 A T 17: 36,873,276 I254F probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r124 G T 17: 18,074,177 R842L probably benign Het
Vmn2r56 T C 7: 12,694,705 R545G probably damaging Het
Vmn2r84 T C 10: 130,386,375 T659A probably damaging Het
Vps13c T C 9: 67,945,521 M2361T probably benign Het
Zfp217 T C 2: 170,115,077 D667G possibly damaging Het
Zfp952 T G 17: 33,002,836 C96W probably benign Het
Zfp959 A G 17: 55,897,836 Q291R possibly damaging Het
Zscan4-ps3 T C 7: 11,610,487 V124A probably benign Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCTGTCTTCCTTGGAAAATTTG -3'
(R):5'- CAGTCCTGCAGAAGCTGTGTTAG -3'

Sequencing Primer
(F):5'- GCCATGGAGAGCATTTAG -3'
(R):5'- ACCATGCTTTAAAACCCTTTATAACC -3'
Posted On 2021-10-11