Incidental Mutation 'R8971:Axdnd1'
ID 683054
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms 9430070O13Rik, LOC381304
MMRRC Submission 068805-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R8971 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 156157985-156248743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 156219516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 193 (A193V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000177824
AA Change: A291V

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: A291V

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178036
AA Change: A356V

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: A356V

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000213088
AA Change: A356V

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T C 14: 34,236,383 (GRCm39) H44R unknown Het
Acp6 C T 3: 97,078,961 (GRCm39) H254Y probably damaging Het
Acvrl1 A G 15: 101,033,404 (GRCm39) N97S possibly damaging Het
Afm T A 5: 90,696,675 (GRCm39) V455E probably damaging Het
Ankrd44 G T 1: 54,692,952 (GRCm39) D927E probably benign Het
Ap2a2 T C 7: 141,191,258 (GRCm39) V275A probably benign Het
Arfgef2 A T 2: 166,701,221 (GRCm39) Q673L probably damaging Het
Atp6v0a2 T C 5: 124,797,061 (GRCm39) F814L probably damaging Het
Bicra T A 7: 15,721,481 (GRCm39) I679L probably benign Het
Ccm2l G A 2: 152,909,756 (GRCm39) R36H probably damaging Het
Cd160 T A 3: 96,713,102 (GRCm39) D54V probably damaging Het
Cela3a C T 4: 137,133,222 (GRCm39) G50D probably benign Het
Cep152 T A 2: 125,421,770 (GRCm39) R987* probably null Het
Cnnm2 T C 19: 46,845,362 (GRCm39) V618A probably benign Het
Crim1 G A 17: 78,653,409 (GRCm39) R593Q possibly damaging Het
Ctsc A G 7: 87,959,024 (GRCm39) S435G probably benign Het
Dcbld1 G T 10: 52,195,958 (GRCm39) A460S probably benign Het
Dcbld2 A G 16: 58,276,715 (GRCm39) E502G probably benign Het
Dhx30 A T 9: 109,913,513 (GRCm39) L1207* probably null Het
Dlx2 A T 2: 71,376,716 (GRCm39) S7R possibly damaging Het
Dmwd T A 7: 18,814,973 (GRCm39) I541N probably damaging Het
Dmxl1 T G 18: 49,997,575 (GRCm39) L588V possibly damaging Het
Dmxl1 C T 18: 50,026,741 (GRCm39) P1950S probably damaging Het
Dnhd1 T A 7: 105,358,528 (GRCm39) L3339* probably null Het
Elovl1 C A 4: 118,288,709 (GRCm39) P160Q probably damaging Het
Epg5 T A 18: 78,022,434 (GRCm39) L1059Q probably damaging Het
Fam149b C T 14: 20,402,777 (GRCm39) S53F probably benign Het
Fat1 T A 8: 45,495,331 (GRCm39) C4140S probably damaging Het
Gria2 C T 3: 80,615,200 (GRCm39) V427I probably damaging Het
H2al2a C A 2: 18,001,537 (GRCm39) A50S probably damaging Het
Hspbp1 T C 7: 4,684,858 (GRCm39) M132V possibly damaging Het
Igsf9 C T 1: 172,312,033 (GRCm39) probably benign Het
Jup C T 11: 100,270,391 (GRCm39) C372Y probably damaging Het
Katnb1 G A 8: 95,822,987 (GRCm39) R394Q probably damaging Het
Kif1b A T 4: 149,332,273 (GRCm39) D553E probably damaging Het
Kif3a T A 11: 53,474,189 (GRCm39) L251Q probably damaging Het
Klb T A 5: 65,533,026 (GRCm39) I445K probably damaging Het
Klhl29 T A 12: 5,190,710 (GRCm39) probably null Het
Lipf A G 19: 33,942,273 (GRCm39) K68E probably benign Het
Lnx2 T A 5: 146,970,236 (GRCm39) I169L probably benign Het
Lrba A C 3: 86,522,388 (GRCm39) I2223L probably benign Het
Lrp1 C T 10: 127,391,896 (GRCm39) D2890N possibly damaging Het
Lrp1b T C 2: 41,325,640 (GRCm39) T926A Het
Lrrc37a T A 11: 103,391,490 (GRCm39) I1312F probably benign Het
Lrrc71 T C 3: 87,647,153 (GRCm39) H477R possibly damaging Het
Lrrc8e T C 8: 4,284,141 (GRCm39) V122A probably damaging Het
Lsm14b T C 2: 179,667,107 (GRCm39) probably null Het
Magel2 A C 7: 62,029,999 (GRCm39) I968L unknown Het
Mapkbp1 T C 2: 119,850,050 (GRCm39) V771A probably benign Het
Mtmr4 T C 11: 87,493,626 (GRCm39) S295P probably benign Het
Nanos3 T A 8: 84,902,815 (GRCm39) T116S probably benign Het
Nectin3 T C 16: 46,269,265 (GRCm39) D379G probably benign Het
Nelfa T C 5: 34,093,539 (GRCm39) H14R possibly damaging Het
Nnt A G 13: 119,502,967 (GRCm39) W593R unknown Het
Nudt2 A T 4: 41,477,575 (GRCm39) M19L probably benign Het
Or4c115 T A 2: 88,927,891 (GRCm39) K127* probably null Het
Or52p1 A T 7: 104,267,467 (GRCm39) T194S probably damaging Het
Or5m13b T C 2: 85,754,328 (GRCm39) S239P probably damaging Het
Or5w22 T A 2: 87,362,580 (GRCm39) C68S probably benign Het
Or6f1 T A 7: 85,970,369 (GRCm39) I264F possibly damaging Het
Palld A T 8: 61,969,735 (GRCm39) D1196E unknown Het
Parl A G 16: 20,116,909 (GRCm39) L96P probably damaging Het
Pip4k2a T C 2: 18,852,367 (GRCm39) D305G probably benign Het
Pkhd1l1 T C 15: 44,392,915 (GRCm39) V1750A possibly damaging Het
Prkdc A G 16: 15,493,229 (GRCm39) E712G probably null Het
Rasgrf2 T C 13: 92,158,225 (GRCm39) E532G possibly damaging Het
Rbp3 T A 14: 33,677,792 (GRCm39) L580Q probably damaging Het
Ribc2 G T 15: 85,016,337 (GRCm39) probably benign Het
Rmnd5b T C 11: 51,515,322 (GRCm39) S315G probably benign Het
Rp1l1 T A 14: 64,259,445 (GRCm39) V29E probably damaging Het
Sclt1 T C 3: 41,681,541 (GRCm39) T93A probably benign Het
Shroom1 T A 11: 53,355,994 (GRCm39) L348H probably damaging Het
Slc13a1 T C 6: 24,090,785 (GRCm39) K545E probably benign Het
Slc20a2 C T 8: 23,030,396 (GRCm39) P151S probably damaging Het
Slc22a4 T C 11: 53,879,718 (GRCm39) Y447C probably damaging Het
Slu7 C A 11: 43,333,480 (GRCm39) Q367K probably benign Het
Spen T C 4: 141,201,889 (GRCm39) N2246S possibly damaging Het
Tac4 T G 11: 95,156,045 (GRCm39) I42S possibly damaging Het
Tmem87a A G 2: 120,190,541 (GRCm39) V530A Het
Tnrc6c T C 11: 117,640,089 (GRCm39) I1208T possibly damaging Het
Vmn1r230 C T 17: 21,067,321 (GRCm39) T170I possibly damaging Het
Vps29 A G 5: 122,498,212 (GRCm39) D51G probably benign Het
Washc2 T C 6: 116,231,399 (GRCm39) L874P probably damaging Het
Wdr5b T C 16: 35,861,926 (GRCm39) L15P probably benign Het
Zscan20 T A 4: 128,479,847 (GRCm39) Q881H probably damaging Het
Zscan20 T G 4: 128,479,848 (GRCm39) Q881P probably damaging Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156,204,233 (GRCm39) missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156,223,012 (GRCm39) missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156,205,959 (GRCm39) missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156,208,456 (GRCm39) missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156,193,259 (GRCm39) missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156,205,950 (GRCm39) critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156,176,530 (GRCm39) missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156,174,271 (GRCm39) missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156,204,114 (GRCm39) missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156,208,344 (GRCm39) splice site probably null
R2126:Axdnd1 UTSW 1 156,160,784 (GRCm39) missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156,219,573 (GRCm39) missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156,245,879 (GRCm39) missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156,193,221 (GRCm39) missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156,220,319 (GRCm39) missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156,208,428 (GRCm39) missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156,246,840 (GRCm39) missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156,159,209 (GRCm39) missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156,204,216 (GRCm39) missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156,223,129 (GRCm39) splice site probably null
R4969:Axdnd1 UTSW 1 156,223,075 (GRCm39) missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156,247,980 (GRCm39) missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156,162,920 (GRCm39) missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156,226,104 (GRCm39) missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156,178,982 (GRCm39) missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156,169,459 (GRCm39) missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156,176,528 (GRCm39) missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156,193,182 (GRCm39) splice site probably null
R6208:Axdnd1 UTSW 1 156,220,426 (GRCm39) intron probably benign
R6369:Axdnd1 UTSW 1 156,220,315 (GRCm39) missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156,208,383 (GRCm39) missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156,158,532 (GRCm39) splice site probably null
R7115:Axdnd1 UTSW 1 156,208,446 (GRCm39) missense
R7203:Axdnd1 UTSW 1 156,209,959 (GRCm39) missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156,210,047 (GRCm39) missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156,245,802 (GRCm39) critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156,204,086 (GRCm39) missense
R7686:Axdnd1 UTSW 1 156,223,034 (GRCm39) nonsense probably null
R7793:Axdnd1 UTSW 1 156,166,313 (GRCm39) critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156,220,371 (GRCm39) nonsense probably null
R7882:Axdnd1 UTSW 1 156,225,023 (GRCm39) missense
R8256:Axdnd1 UTSW 1 156,158,236 (GRCm39) missense unknown
R8348:Axdnd1 UTSW 1 156,245,854 (GRCm39) missense probably benign 0.02
R9207:Axdnd1 UTSW 1 156,215,616 (GRCm39) missense
R9294:Axdnd1 UTSW 1 156,247,917 (GRCm39) nonsense probably null
R9741:Axdnd1 UTSW 1 156,169,385 (GRCm39) missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156,215,649 (GRCm39) missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156,204,105 (GRCm39) missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156,176,633 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCAAGCTTCCGCACAG -3'
(R):5'- TAAAAGGTGTGCCTGCCACC -3'

Sequencing Primer
(F):5'- CAGCCCTAAGAAGCAGGTGAC -3'
(R):5'- AGGTGTGCCTGCCACCTAATG -3'
Posted On 2021-10-11