Incidental Mutation 'R8971:Axdnd1'
ID 683054
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms LOC381304, 9430070O13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8971 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 156323509-156421159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 156391946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 193 (A193V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000177824
AA Change: A291V

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: A291V

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178036
AA Change: A356V

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: A356V

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000213088
AA Change: A356V

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T C 14: 34,514,426 H44R unknown Het
Acp6 C T 3: 97,171,645 H254Y probably damaging Het
Acvrl1 A G 15: 101,135,523 N97S possibly damaging Het
Afm T A 5: 90,548,816 V455E probably damaging Het
Ankrd44 G T 1: 54,653,793 D927E probably benign Het
Ap2a2 T C 7: 141,611,345 V275A probably benign Het
Arfgef2 A T 2: 166,859,301 Q673L probably damaging Het
Atp6v0a2 T C 5: 124,719,997 F814L probably damaging Het
Bicra T A 7: 15,987,556 I679L probably benign Het
Ccm2l G A 2: 153,067,836 R36H probably damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Cela3a C T 4: 137,405,911 G50D probably benign Het
Cep152 T A 2: 125,579,850 R987* probably null Het
Cnnm2 T C 19: 46,856,923 V618A probably benign Het
Crim1 G A 17: 78,345,980 R593Q possibly damaging Het
Ctsc A G 7: 88,309,816 S435G probably benign Het
Dcbld1 G T 10: 52,319,862 A460S probably benign Het
Dcbld2 A G 16: 58,456,352 E502G probably benign Het
Dhx30 A T 9: 110,084,445 L1207* probably null Het
Dlx2 A T 2: 71,546,372 S7R possibly damaging Het
Dmwd T A 7: 19,081,048 I541N probably damaging Het
Dmxl1 T G 18: 49,864,508 L588V possibly damaging Het
Dmxl1 C T 18: 49,893,674 P1950S probably damaging Het
Dnhd1 T A 7: 105,709,321 L3339* probably null Het
Elovl1 C A 4: 118,431,512 P160Q probably damaging Het
Epg5 T A 18: 77,979,219 L1059Q probably damaging Het
Fam149b C T 14: 20,352,709 S53F probably benign Het
Fat1 T A 8: 45,042,294 C4140S probably damaging Het
Gria2 C T 3: 80,707,893 V427I probably damaging Het
H2al2a C A 2: 17,996,726 A50S probably damaging Het
Hspbp1 T C 7: 4,681,859 M132V possibly damaging Het
Igsf9 C T 1: 172,484,466 probably benign Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Katnb1 G A 8: 95,096,359 R394Q probably damaging Het
Kif1b A T 4: 149,247,816 D553E probably damaging Het
Kif3a T A 11: 53,583,362 L251Q probably damaging Het
Klb T A 5: 65,375,683 I445K probably damaging Het
Klhl29 T A 12: 5,140,710 probably null Het
Lipf A G 19: 33,964,873 K68E probably benign Het
Lnx2 T A 5: 147,033,426 I169L probably benign Het
Lrba A C 3: 86,615,081 I2223L probably benign Het
Lrp1 C T 10: 127,556,027 D2890N possibly damaging Het
Lrp1b T C 2: 41,435,628 T926A Het
Lrrc37a T A 11: 103,500,664 I1312F probably benign Het
Lrrc71 T C 3: 87,739,846 H477R possibly damaging Het
Lrrc8e T C 8: 4,234,141 V122A probably damaging Het
Lsm14b T C 2: 180,025,314 probably null Het
Magel2 A C 7: 62,380,251 I968L unknown Het
Mapkbp1 T C 2: 120,019,569 V771A probably benign Het
Mtmr4 T C 11: 87,602,800 S295P probably benign Het
Nanos3 T A 8: 84,176,186 T116S probably benign Het
Nectin3 T C 16: 46,448,902 D379G probably benign Het
Nelfa T C 5: 33,936,195 H14R possibly damaging Het
Nnt A G 13: 119,366,431 W593R unknown Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Olfr1026 T C 2: 85,923,984 S239P probably damaging Het
Olfr1220 T A 2: 89,097,547 K127* probably null Het
Olfr153 T A 2: 87,532,236 C68S probably benign Het
Olfr308 T A 7: 86,321,161 I264F possibly damaging Het
Olfr656 A T 7: 104,618,260 T194S probably damaging Het
Palld A T 8: 61,516,701 D1196E unknown Het
Parl A G 16: 20,298,159 L96P probably damaging Het
Pip4k2a T C 2: 18,847,556 D305G probably benign Het
Pkhd1l1 T C 15: 44,529,519 V1750A possibly damaging Het
Prkdc A G 16: 15,675,365 E712G probably null Het
Rasgrf2 T C 13: 92,021,717 E532G possibly damaging Het
Rbp3 T A 14: 33,955,835 L580Q probably damaging Het
Ribc2 G T 15: 85,132,136 probably benign Het
Rmnd5b T C 11: 51,624,495 S315G probably benign Het
Rp1l1 T A 14: 64,021,996 V29E probably damaging Het
Sclt1 T C 3: 41,727,106 T93A probably benign Het
Shroom1 T A 11: 53,465,167 L348H probably damaging Het
Slc13a1 T C 6: 24,090,786 K545E probably benign Het
Slc20a2 C T 8: 22,540,380 P151S probably damaging Het
Slc22a4 T C 11: 53,988,892 Y447C probably damaging Het
Slu7 C A 11: 43,442,653 Q367K probably benign Het
Spen T C 4: 141,474,578 N2246S possibly damaging Het
Tac4 T G 11: 95,265,219 I42S possibly damaging Het
Tmem87a A G 2: 120,360,060 V530A Het
Tnrc6c T C 11: 117,749,263 I1208T possibly damaging Het
Vmn1r230 C T 17: 20,847,059 T170I possibly damaging Het
Vps29 A G 5: 122,360,149 D51G probably benign Het
Washc2 T C 6: 116,254,438 L874P probably damaging Het
Wdr5b T C 16: 36,041,556 L15P probably benign Het
Zscan20 T A 4: 128,586,054 Q881H probably damaging Het
Zscan20 T G 4: 128,586,055 Q881P probably damaging Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156376663 missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156395442 missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156378389 missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156380886 missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156365689 missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156378380 critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156348960 missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156346701 missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156376544 missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156380774 splice site probably null
R2126:Axdnd1 UTSW 1 156333214 missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156392003 missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156418309 missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156365651 missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156392749 missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156380858 missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156419270 missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156331639 missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156376646 missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156395559 splice site probably null
R4969:Axdnd1 UTSW 1 156395505 missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156420410 missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156335350 missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156398534 missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156351412 missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156341889 missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156348958 missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156365612 splice site probably null
R6208:Axdnd1 UTSW 1 156392856 intron probably benign
R6369:Axdnd1 UTSW 1 156392745 missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156380813 missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156330962 splice site probably null
R7115:Axdnd1 UTSW 1 156380876 missense
R7203:Axdnd1 UTSW 1 156382389 missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156382477 missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156418232 critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156376516 missense
R7686:Axdnd1 UTSW 1 156395464 nonsense probably null
R7793:Axdnd1 UTSW 1 156338743 critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156392801 nonsense probably null
R7882:Axdnd1 UTSW 1 156397453 missense
R8256:Axdnd1 UTSW 1 156330666 missense unknown
R8348:Axdnd1 UTSW 1 156418284 missense probably benign 0.02
R9207:Axdnd1 UTSW 1 156388046 missense
R9294:Axdnd1 UTSW 1 156420347 nonsense probably null
R9741:Axdnd1 UTSW 1 156341815 missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156388079 missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156376535 missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156349063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCAAGCTTCCGCACAG -3'
(R):5'- TAAAAGGTGTGCCTGCCACC -3'

Sequencing Primer
(F):5'- CAGCCCTAAGAAGCAGGTGAC -3'
(R):5'- AGGTGTGCCTGCCACCTAATG -3'
Posted On 2021-10-11