Incidental Mutation 'R8971:Lnx2'
ID 683087
Institutional Source Beutler Lab
Gene Symbol Lnx2
Ensembl Gene ENSMUSG00000016520
Gene Name ligand of numb-protein X 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8971 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 147016655-147076586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 147033426 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 169 (I169L)
Ref Sequence ENSEMBL: ENSMUSP00000016664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016664]
AlphaFold Q91XL2
Predicted Effect probably benign
Transcript: ENSMUST00000016664
AA Change: I169L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016664
Gene: ENSMUSG00000016520
AA Change: I169L

DomainStartEndE-ValueType
RING 51 88 2.06e-6 SMART
low complexity region 103 114 N/A INTRINSIC
PDZ 242 317 2.25e-17 SMART
PDZ 348 421 2.97e-17 SMART
PDZ 474 553 7.37e-13 SMART
PDZ 606 683 1.27e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T C 14: 34,514,426 H44R unknown Het
Acp6 C T 3: 97,171,645 H254Y probably damaging Het
Acvrl1 A G 15: 101,135,523 N97S possibly damaging Het
Afm T A 5: 90,548,816 V455E probably damaging Het
Ankrd44 G T 1: 54,653,793 D927E probably benign Het
Ap2a2 T C 7: 141,611,345 V275A probably benign Het
Arfgef2 A T 2: 166,859,301 Q673L probably damaging Het
Atp6v0a2 T C 5: 124,719,997 F814L probably damaging Het
Axdnd1 G A 1: 156,391,946 A193V Het
Bicra T A 7: 15,987,556 I679L probably benign Het
Ccm2l G A 2: 153,067,836 R36H probably damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Cela3a C T 4: 137,405,911 G50D probably benign Het
Cep152 T A 2: 125,579,850 R987* probably null Het
Cnnm2 T C 19: 46,856,923 V618A probably benign Het
Crim1 G A 17: 78,345,980 R593Q possibly damaging Het
Ctsc A G 7: 88,309,816 S435G probably benign Het
Dcbld1 G T 10: 52,319,862 A460S probably benign Het
Dcbld2 A G 16: 58,456,352 E502G probably benign Het
Dhx30 A T 9: 110,084,445 L1207* probably null Het
Dlx2 A T 2: 71,546,372 S7R possibly damaging Het
Dmwd T A 7: 19,081,048 I541N probably damaging Het
Dmxl1 T G 18: 49,864,508 L588V possibly damaging Het
Dmxl1 C T 18: 49,893,674 P1950S probably damaging Het
Dnhd1 T A 7: 105,709,321 L3339* probably null Het
Elovl1 C A 4: 118,431,512 P160Q probably damaging Het
Epg5 T A 18: 77,979,219 L1059Q probably damaging Het
Fam149b C T 14: 20,352,709 S53F probably benign Het
Fat1 T A 8: 45,042,294 C4140S probably damaging Het
Gria2 C T 3: 80,707,893 V427I probably damaging Het
H2al2a C A 2: 17,996,726 A50S probably damaging Het
Hspbp1 T C 7: 4,681,859 M132V possibly damaging Het
Igsf9 C T 1: 172,484,466 probably benign Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Katnb1 G A 8: 95,096,359 R394Q probably damaging Het
Kif1b A T 4: 149,247,816 D553E probably damaging Het
Kif3a T A 11: 53,583,362 L251Q probably damaging Het
Klb T A 5: 65,375,683 I445K probably damaging Het
Klhl29 T A 12: 5,140,710 probably null Het
Lipf A G 19: 33,964,873 K68E probably benign Het
Lrba A C 3: 86,615,081 I2223L probably benign Het
Lrp1 C T 10: 127,556,027 D2890N possibly damaging Het
Lrp1b T C 2: 41,435,628 T926A Het
Lrrc37a T A 11: 103,500,664 I1312F probably benign Het
Lrrc71 T C 3: 87,739,846 H477R possibly damaging Het
Lrrc8e T C 8: 4,234,141 V122A probably damaging Het
Lsm14b T C 2: 180,025,314 probably null Het
Magel2 A C 7: 62,380,251 I968L unknown Het
Mapkbp1 T C 2: 120,019,569 V771A probably benign Het
Mtmr4 T C 11: 87,602,800 S295P probably benign Het
Nanos3 T A 8: 84,176,186 T116S probably benign Het
Nectin3 T C 16: 46,448,902 D379G probably benign Het
Nelfa T C 5: 33,936,195 H14R possibly damaging Het
Nnt A G 13: 119,366,431 W593R unknown Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Olfr1026 T C 2: 85,923,984 S239P probably damaging Het
Olfr1220 T A 2: 89,097,547 K127* probably null Het
Olfr153 T A 2: 87,532,236 C68S probably benign Het
Olfr308 T A 7: 86,321,161 I264F possibly damaging Het
Olfr656 A T 7: 104,618,260 T194S probably damaging Het
Palld A T 8: 61,516,701 D1196E unknown Het
Parl A G 16: 20,298,159 L96P probably damaging Het
Pip4k2a T C 2: 18,847,556 D305G probably benign Het
Pkhd1l1 T C 15: 44,529,519 V1750A possibly damaging Het
Prkdc A G 16: 15,675,365 E712G probably null Het
Rasgrf2 T C 13: 92,021,717 E532G possibly damaging Het
Rbp3 T A 14: 33,955,835 L580Q probably damaging Het
Ribc2 G T 15: 85,132,136 probably benign Het
Rmnd5b T C 11: 51,624,495 S315G probably benign Het
Rp1l1 T A 14: 64,021,996 V29E probably damaging Het
Sclt1 T C 3: 41,727,106 T93A probably benign Het
Shroom1 T A 11: 53,465,167 L348H probably damaging Het
Slc13a1 T C 6: 24,090,786 K545E probably benign Het
Slc20a2 C T 8: 22,540,380 P151S probably damaging Het
Slc22a4 T C 11: 53,988,892 Y447C probably damaging Het
Slu7 C A 11: 43,442,653 Q367K probably benign Het
Spen T C 4: 141,474,578 N2246S possibly damaging Het
Tac4 T G 11: 95,265,219 I42S possibly damaging Het
Tmem87a A G 2: 120,360,060 V530A Het
Tnrc6c T C 11: 117,749,263 I1208T possibly damaging Het
Vmn1r230 C T 17: 20,847,059 T170I possibly damaging Het
Vps29 A G 5: 122,360,149 D51G probably benign Het
Washc2 T C 6: 116,254,438 L874P probably damaging Het
Wdr5b T C 16: 36,041,556 L15P probably benign Het
Zscan20 T A 4: 128,586,054 Q881H probably damaging Het
Zscan20 T G 4: 128,586,055 Q881P probably damaging Het
Other mutations in Lnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02593:Lnx2 APN 5 147033015 missense possibly damaging 0.81
IGL02657:Lnx2 APN 5 147028174 missense probably damaging 1.00
IGL02820:Lnx2 APN 5 147042067 missense probably damaging 0.98
R0051:Lnx2 UTSW 5 147029353 missense probably damaging 0.96
R0389:Lnx2 UTSW 5 147019040 missense possibly damaging 0.51
R0482:Lnx2 UTSW 5 147018961 missense probably damaging 0.99
R1601:Lnx2 UTSW 5 147033519 missense probably damaging 0.99
R1604:Lnx2 UTSW 5 147029325 missense probably benign 0.02
R1647:Lnx2 UTSW 5 147027342 missense probably benign 0.04
R3001:Lnx2 UTSW 5 147019015 missense probably benign 0.00
R3002:Lnx2 UTSW 5 147019015 missense probably benign 0.00
R4734:Lnx2 UTSW 5 147029137 missense probably damaging 1.00
R4960:Lnx2 UTSW 5 147019040 missense probably benign 0.09
R5387:Lnx2 UTSW 5 147028154 missense probably benign 0.00
R5689:Lnx2 UTSW 5 147029151 missense probably damaging 1.00
R5950:Lnx2 UTSW 5 147024350 critical splice donor site probably null
R6161:Lnx2 UTSW 5 147042026 splice site probably null
R6623:Lnx2 UTSW 5 147024487 missense probably damaging 1.00
R7086:Lnx2 UTSW 5 147020178 splice site probably null
R7320:Lnx2 UTSW 5 147020133 missense possibly damaging 0.71
R7701:Lnx2 UTSW 5 147024523 missense probably damaging 1.00
R7887:Lnx2 UTSW 5 147019043 missense probably damaging 1.00
R8153:Lnx2 UTSW 5 147028096 missense probably benign
R8267:Lnx2 UTSW 5 147029091 missense probably damaging 1.00
R8298:Lnx2 UTSW 5 147024517 missense probably benign 0.05
R8384:Lnx2 UTSW 5 147029328 missense probably benign 0.01
R8446:Lnx2 UTSW 5 147033359 missense probably benign
R9378:Lnx2 UTSW 5 147024370 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACTCCAGTGCAACTGTCTG -3'
(R):5'- TGTTGATCAACCCCACCTAC -3'

Sequencing Primer
(F):5'- TGTCTGGACAGGACACGAGC -3'
(R):5'- GATCAACCCCACCTACCCTCTTC -3'
Posted On 2021-10-11