Incidental Mutation 'R8971:Rasgrf2'
ID 683119
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene Name RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms Grf2, 6330417G04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock # R8971 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 91880400-92131656 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92021717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 532 (E532G)
Ref Sequence ENSEMBL: ENSMUSP00000096930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000216219]
AlphaFold P70392
Predicted Effect possibly damaging
Transcript: ENSMUST00000099326
AA Change: E532G

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: E532G

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216219
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T C 14: 34,514,426 H44R unknown Het
Acp6 C T 3: 97,171,645 H254Y probably damaging Het
Acvrl1 A G 15: 101,135,523 N97S possibly damaging Het
Afm T A 5: 90,548,816 V455E probably damaging Het
Ankrd44 G T 1: 54,653,793 D927E probably benign Het
Ap2a2 T C 7: 141,611,345 V275A probably benign Het
Arfgef2 A T 2: 166,859,301 Q673L probably damaging Het
Atp6v0a2 T C 5: 124,719,997 F814L probably damaging Het
Axdnd1 G A 1: 156,391,946 A193V Het
Bicra T A 7: 15,987,556 I679L probably benign Het
Ccm2l G A 2: 153,067,836 R36H probably damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Cela3a C T 4: 137,405,911 G50D probably benign Het
Cep152 T A 2: 125,579,850 R987* probably null Het
Cnnm2 T C 19: 46,856,923 V618A probably benign Het
Crim1 G A 17: 78,345,980 R593Q possibly damaging Het
Ctsc A G 7: 88,309,816 S435G probably benign Het
Dcbld1 G T 10: 52,319,862 A460S probably benign Het
Dcbld2 A G 16: 58,456,352 E502G probably benign Het
Dhx30 A T 9: 110,084,445 L1207* probably null Het
Dlx2 A T 2: 71,546,372 S7R possibly damaging Het
Dmwd T A 7: 19,081,048 I541N probably damaging Het
Dmxl1 T G 18: 49,864,508 L588V possibly damaging Het
Dmxl1 C T 18: 49,893,674 P1950S probably damaging Het
Dnhd1 T A 7: 105,709,321 L3339* probably null Het
Elovl1 C A 4: 118,431,512 P160Q probably damaging Het
Epg5 T A 18: 77,979,219 L1059Q probably damaging Het
Fam149b C T 14: 20,352,709 S53F probably benign Het
Fat1 T A 8: 45,042,294 C4140S probably damaging Het
Gria2 C T 3: 80,707,893 V427I probably damaging Het
H2al2a C A 2: 17,996,726 A50S probably damaging Het
Hspbp1 T C 7: 4,681,859 M132V possibly damaging Het
Igsf9 C T 1: 172,484,466 probably benign Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Katnb1 G A 8: 95,096,359 R394Q probably damaging Het
Kif1b A T 4: 149,247,816 D553E probably damaging Het
Kif3a T A 11: 53,583,362 L251Q probably damaging Het
Klb T A 5: 65,375,683 I445K probably damaging Het
Klhl29 T A 12: 5,140,710 probably null Het
Lipf A G 19: 33,964,873 K68E probably benign Het
Lnx2 T A 5: 147,033,426 I169L probably benign Het
Lrba A C 3: 86,615,081 I2223L probably benign Het
Lrp1 C T 10: 127,556,027 D2890N possibly damaging Het
Lrp1b T C 2: 41,435,628 T926A Het
Lrrc37a T A 11: 103,500,664 I1312F probably benign Het
Lrrc71 T C 3: 87,739,846 H477R possibly damaging Het
Lrrc8e T C 8: 4,234,141 V122A probably damaging Het
Lsm14b T C 2: 180,025,314 probably null Het
Magel2 A C 7: 62,380,251 I968L unknown Het
Mapkbp1 T C 2: 120,019,569 V771A probably benign Het
Mtmr4 T C 11: 87,602,800 S295P probably benign Het
Nanos3 T A 8: 84,176,186 T116S probably benign Het
Nectin3 T C 16: 46,448,902 D379G probably benign Het
Nelfa T C 5: 33,936,195 H14R possibly damaging Het
Nnt A G 13: 119,366,431 W593R unknown Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Olfr1026 T C 2: 85,923,984 S239P probably damaging Het
Olfr1220 T A 2: 89,097,547 K127* probably null Het
Olfr153 T A 2: 87,532,236 C68S probably benign Het
Olfr308 T A 7: 86,321,161 I264F possibly damaging Het
Olfr656 A T 7: 104,618,260 T194S probably damaging Het
Palld A T 8: 61,516,701 D1196E unknown Het
Parl A G 16: 20,298,159 L96P probably damaging Het
Pip4k2a T C 2: 18,847,556 D305G probably benign Het
Pkhd1l1 T C 15: 44,529,519 V1750A possibly damaging Het
Prkdc A G 16: 15,675,365 E712G probably null Het
Rbp3 T A 14: 33,955,835 L580Q probably damaging Het
Ribc2 G T 15: 85,132,136 probably benign Het
Rmnd5b T C 11: 51,624,495 S315G probably benign Het
Rp1l1 T A 14: 64,021,996 V29E probably damaging Het
Sclt1 T C 3: 41,727,106 T93A probably benign Het
Shroom1 T A 11: 53,465,167 L348H probably damaging Het
Slc13a1 T C 6: 24,090,786 K545E probably benign Het
Slc20a2 C T 8: 22,540,380 P151S probably damaging Het
Slc22a4 T C 11: 53,988,892 Y447C probably damaging Het
Slu7 C A 11: 43,442,653 Q367K probably benign Het
Spen T C 4: 141,474,578 N2246S possibly damaging Het
Tac4 T G 11: 95,265,219 I42S possibly damaging Het
Tmem87a A G 2: 120,360,060 V530A Het
Tnrc6c T C 11: 117,749,263 I1208T possibly damaging Het
Vmn1r230 C T 17: 20,847,059 T170I possibly damaging Het
Vps29 A G 5: 122,360,149 D51G probably benign Het
Washc2 T C 6: 116,254,438 L874P probably damaging Het
Wdr5b T C 16: 36,041,556 L15P probably benign Het
Zscan20 T A 4: 128,586,054 Q881H probably damaging Het
Zscan20 T G 4: 128,586,055 Q881P probably damaging Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 91884518 nonsense probably null
R7392:Rasgrf2 UTSW 13 91893737 missense
R7469:Rasgrf2 UTSW 13 92029022 critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 91987966 missense
R7641:Rasgrf2 UTSW 13 92131406 missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92131406 missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 91896082 missense
R7962:Rasgrf2 UTSW 13 92030792 missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92030813 missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 91982677 missense
R8796:Rasgrf2 UTSW 13 91890566 missense
R8913:Rasgrf2 UTSW 13 92022526 missense probably benign 0.05
R9020:Rasgrf2 UTSW 13 92028638 missense possibly damaging 0.93
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 91983513 missense
Z1177:Rasgrf2 UTSW 13 92022573 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGGGACACAGTCTGCACAG -3'
(R):5'- AATCATTAGTGCTGCGTCTGG -3'

Sequencing Primer
(F):5'- CACAGGGCAATAAGACAGAAATAG -3'
(R):5'- GGTGTGCCAACATTATTTGAAGC -3'
Posted On 2021-10-11