Incidental Mutation 'R8971:Dmxl1'
ID683135
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R8971 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 49864508 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 588 (L588V)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041772
AA Change: L588V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: L588V

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000180611
AA Change: L588V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: L588V

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T C 14: 34,514,426 H44R unknown Het
Acp6 C T 3: 97,171,645 H254Y probably damaging Het
Acvrl1 A G 15: 101,135,523 N97S possibly damaging Het
Afm T A 5: 90,548,816 V455E probably damaging Het
Ankrd44 G T 1: 54,653,793 D927E probably benign Het
Ap2a2 T C 7: 141,611,345 V275A probably benign Het
Arfgef2 A T 2: 166,859,301 Q673L probably damaging Het
Atp6v0a2 T C 5: 124,719,997 F814L probably damaging Het
Axdnd1 G A 1: 156,391,946 A193V Het
Bicra T A 7: 15,987,556 I679L probably benign Het
Ccm2l G A 2: 153,067,836 R36H probably damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Cela3a C T 4: 137,405,911 G50D probably benign Het
Cep152 T A 2: 125,579,850 R987* probably null Het
Cnnm2 T C 19: 46,856,923 V618A probably benign Het
Crim1 G A 17: 78,345,980 R593Q possibly damaging Het
Ctsc A G 7: 88,309,816 S435G probably benign Het
Dcbld1 G T 10: 52,319,862 A460S probably benign Het
Dcbld2 A G 16: 58,456,352 E502G probably benign Het
Dhx30 A T 9: 110,084,445 L1207* probably null Het
Dlx2 A T 2: 71,546,372 S7R possibly damaging Het
Dmwd T A 7: 19,081,048 I541N probably damaging Het
Dnhd1 T A 7: 105,709,321 L3339* probably null Het
Elovl1 C A 4: 118,431,512 P160Q probably damaging Het
Epg5 T A 18: 77,979,219 L1059Q probably damaging Het
Fam149b C T 14: 20,352,709 S53F probably benign Het
Fat1 T A 8: 45,042,294 C4140S probably damaging Het
Gria2 C T 3: 80,707,893 V427I probably damaging Het
H2al2a C A 2: 17,996,726 A50S probably damaging Het
Hspbp1 T C 7: 4,681,859 M132V possibly damaging Het
Igsf9 C T 1: 172,484,466 probably benign Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Katnb1 G A 8: 95,096,359 R394Q probably damaging Het
Kif1b A T 4: 149,247,816 D553E probably damaging Het
Kif3a T A 11: 53,583,362 L251Q probably damaging Het
Klb T A 5: 65,375,683 I445K probably damaging Het
Klhl29 T A 12: 5,140,710 probably null Het
Lipf A G 19: 33,964,873 K68E probably benign Het
Lnx2 T A 5: 147,033,426 I169L probably benign Het
Lrba A C 3: 86,615,081 I2223L probably benign Het
Lrp1 C T 10: 127,556,027 D2890N possibly damaging Het
Lrp1b T C 2: 41,435,628 T926A Het
Lrrc37a T A 11: 103,500,664 I1312F probably benign Het
Lrrc71 T C 3: 87,739,846 H477R possibly damaging Het
Lrrc8e T C 8: 4,234,141 V122A probably damaging Het
Lsm14b T C 2: 180,025,314 probably null Het
Magel2 A C 7: 62,380,251 I968L unknown Het
Mapkbp1 T C 2: 120,019,569 V771A probably benign Het
Mtmr4 T C 11: 87,602,800 S295P probably benign Het
Nanos3 T A 8: 84,176,186 T116S probably benign Het
Nectin3 T C 16: 46,448,902 D379G probably benign Het
Nelfa T C 5: 33,936,195 H14R possibly damaging Het
Nnt A G 13: 119,366,431 W593R unknown Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Olfr1026 T C 2: 85,923,984 S239P probably damaging Het
Olfr1220 T A 2: 89,097,547 K127* probably null Het
Olfr153 T A 2: 87,532,236 C68S probably benign Het
Olfr308 T A 7: 86,321,161 I264F possibly damaging Het
Olfr656 A T 7: 104,618,260 T194S probably damaging Het
Palld A T 8: 61,516,701 D1196E unknown Het
Parl A G 16: 20,298,159 L96P probably damaging Het
Pip4k2a T C 2: 18,847,556 D305G probably benign Het
Pkhd1l1 T C 15: 44,529,519 V1750A possibly damaging Het
Prkdc A G 16: 15,675,365 E712G probably null Het
Rasgrf2 T C 13: 92,021,717 E532G possibly damaging Het
Rbp3 T A 14: 33,955,835 L580Q probably damaging Het
Ribc2 G T 15: 85,132,136 probably benign Het
Rmnd5b T C 11: 51,624,495 S315G probably benign Het
Rp1l1 T A 14: 64,021,996 V29E probably damaging Het
Sclt1 T C 3: 41,727,106 T93A probably benign Het
Shroom1 T A 11: 53,465,167 L348H probably damaging Het
Slc13a1 T C 6: 24,090,786 K545E probably benign Het
Slc20a2 C T 8: 22,540,380 P151S probably damaging Het
Slc22a4 T C 11: 53,988,892 Y447C probably damaging Het
Slu7 C A 11: 43,442,653 Q367K probably benign Het
Spen T C 4: 141,474,578 N2246S possibly damaging Het
Tac4 T G 11: 95,265,219 I42S possibly damaging Het
Tmem87a A G 2: 120,360,060 V530A Het
Tnrc6c T C 11: 117,749,263 I1208T possibly damaging Het
Vmn1r230 C T 17: 20,847,059 T170I possibly damaging Het
Vps29 A G 5: 122,360,149 D51G probably benign Het
Washc2 T C 6: 116,254,438 L874P probably damaging Het
Wdr5b T C 16: 36,041,556 L15P probably benign Het
Zscan20 T A 4: 128,586,054 Q881H probably damaging Het
Zscan20 T G 4: 128,586,055 Q881P probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
carnivora UTSW 18 49864383 missense probably damaging 0.99
hibiscus UTSW 18 49889467 missense probably damaging 1.00
pitcher UTSW 18 49864148 missense probably damaging 1.00
R3889_Dmxl1_217 UTSW 18 49878259 missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49931963 missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 49955853 missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49864614 missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 49878612 missense probably benign 0.00
R7570:Dmxl1 UTSW 18 49893957 missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 49902794 missense probably benign
R7629:Dmxl1 UTSW 18 49859270 missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 49893552 missense probably benign
R7688:Dmxl1 UTSW 18 49955871 missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49846618 missense probably benign 0.00
R7712:Dmxl1 UTSW 18 49893461 missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 49878315 missense probably benign 0.00
R7834:Dmxl1 UTSW 18 49920977 missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49840490 missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 49961147 missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49864383 missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 49893407 missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 49878433 missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 49888830 missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49843811 missense probably benign 0.17
R8371:Dmxl1 UTSW 18 49898714 missense probably benign 0.08
R8402:Dmxl1 UTSW 18 49878326 nonsense probably null
R8402:Dmxl1 UTSW 18 49878327 missense probably benign 0.09
R8402:Dmxl1 UTSW 18 49878342 missense probably benign
R8423:Dmxl1 UTSW 18 49865116 missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 49871692 nonsense probably null
R8702:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R8749:Dmxl1 UTSW 18 49955870 missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 49957339 missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 49878225 missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 49939572 missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49893674 missense probably damaging 1.00
R8978:Dmxl1 UTSW 18 49922612 missense probably benign 0.37
R8987:Dmxl1 UTSW 18 49893852 missense
R9011:Dmxl1 UTSW 18 49864173 missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 49893394 missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Z1188:Dmxl1 UTSW 18 49868003 missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 49868003 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCCCACAGGTGATGCAAAC -3'
(R):5'- GCTTGCTTTTGGTTACCAACATTTG -3'

Sequencing Primer
(F):5'- CACAGGTGATGCAAACTCTCTTTG -3'
(R):5'- CCTTAATGCATTATGGTGTGACG -3'
Posted On2021-10-11