Incidental Mutation 'R8971:Epg5'
ID 683137
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Name ectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock # R8971 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 77938467-78035027 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77979219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1059 (L1059Q)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
AlphaFold Q80TA9
Predicted Effect probably damaging
Transcript: ENSMUST00000044622
AA Change: L1059Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: L1059Q

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T C 14: 34,514,426 H44R unknown Het
Acp6 C T 3: 97,171,645 H254Y probably damaging Het
Acvrl1 A G 15: 101,135,523 N97S possibly damaging Het
Afm T A 5: 90,548,816 V455E probably damaging Het
Ankrd44 G T 1: 54,653,793 D927E probably benign Het
Ap2a2 T C 7: 141,611,345 V275A probably benign Het
Arfgef2 A T 2: 166,859,301 Q673L probably damaging Het
Atp6v0a2 T C 5: 124,719,997 F814L probably damaging Het
Axdnd1 G A 1: 156,391,946 A193V Het
Bicra T A 7: 15,987,556 I679L probably benign Het
Ccm2l G A 2: 153,067,836 R36H probably damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Cela3a C T 4: 137,405,911 G50D probably benign Het
Cep152 T A 2: 125,579,850 R987* probably null Het
Cnnm2 T C 19: 46,856,923 V618A probably benign Het
Crim1 G A 17: 78,345,980 R593Q possibly damaging Het
Ctsc A G 7: 88,309,816 S435G probably benign Het
Dcbld1 G T 10: 52,319,862 A460S probably benign Het
Dcbld2 A G 16: 58,456,352 E502G probably benign Het
Dhx30 A T 9: 110,084,445 L1207* probably null Het
Dlx2 A T 2: 71,546,372 S7R possibly damaging Het
Dmwd T A 7: 19,081,048 I541N probably damaging Het
Dmxl1 T G 18: 49,864,508 L588V possibly damaging Het
Dmxl1 C T 18: 49,893,674 P1950S probably damaging Het
Dnhd1 T A 7: 105,709,321 L3339* probably null Het
Elovl1 C A 4: 118,431,512 P160Q probably damaging Het
Fam149b C T 14: 20,352,709 S53F probably benign Het
Fat1 T A 8: 45,042,294 C4140S probably damaging Het
Gria2 C T 3: 80,707,893 V427I probably damaging Het
H2al2a C A 2: 17,996,726 A50S probably damaging Het
Hspbp1 T C 7: 4,681,859 M132V possibly damaging Het
Igsf9 C T 1: 172,484,466 probably benign Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Katnb1 G A 8: 95,096,359 R394Q probably damaging Het
Kif1b A T 4: 149,247,816 D553E probably damaging Het
Kif3a T A 11: 53,583,362 L251Q probably damaging Het
Klb T A 5: 65,375,683 I445K probably damaging Het
Klhl29 T A 12: 5,140,710 probably null Het
Lipf A G 19: 33,964,873 K68E probably benign Het
Lnx2 T A 5: 147,033,426 I169L probably benign Het
Lrba A C 3: 86,615,081 I2223L probably benign Het
Lrp1 C T 10: 127,556,027 D2890N possibly damaging Het
Lrp1b T C 2: 41,435,628 T926A Het
Lrrc37a T A 11: 103,500,664 I1312F probably benign Het
Lrrc71 T C 3: 87,739,846 H477R possibly damaging Het
Lrrc8e T C 8: 4,234,141 V122A probably damaging Het
Lsm14b T C 2: 180,025,314 probably null Het
Magel2 A C 7: 62,380,251 I968L unknown Het
Mapkbp1 T C 2: 120,019,569 V771A probably benign Het
Mtmr4 T C 11: 87,602,800 S295P probably benign Het
Nanos3 T A 8: 84,176,186 T116S probably benign Het
Nectin3 T C 16: 46,448,902 D379G probably benign Het
Nelfa T C 5: 33,936,195 H14R possibly damaging Het
Nnt A G 13: 119,366,431 W593R unknown Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Olfr1026 T C 2: 85,923,984 S239P probably damaging Het
Olfr1220 T A 2: 89,097,547 K127* probably null Het
Olfr153 T A 2: 87,532,236 C68S probably benign Het
Olfr308 T A 7: 86,321,161 I264F possibly damaging Het
Olfr656 A T 7: 104,618,260 T194S probably damaging Het
Palld A T 8: 61,516,701 D1196E unknown Het
Parl A G 16: 20,298,159 L96P probably damaging Het
Pip4k2a T C 2: 18,847,556 D305G probably benign Het
Pkhd1l1 T C 15: 44,529,519 V1750A possibly damaging Het
Prkdc A G 16: 15,675,365 E712G probably null Het
Rasgrf2 T C 13: 92,021,717 E532G possibly damaging Het
Rbp3 T A 14: 33,955,835 L580Q probably damaging Het
Ribc2 G T 15: 85,132,136 probably benign Het
Rmnd5b T C 11: 51,624,495 S315G probably benign Het
Rp1l1 T A 14: 64,021,996 V29E probably damaging Het
Sclt1 T C 3: 41,727,106 T93A probably benign Het
Shroom1 T A 11: 53,465,167 L348H probably damaging Het
Slc13a1 T C 6: 24,090,786 K545E probably benign Het
Slc20a2 C T 8: 22,540,380 P151S probably damaging Het
Slc22a4 T C 11: 53,988,892 Y447C probably damaging Het
Slu7 C A 11: 43,442,653 Q367K probably benign Het
Spen T C 4: 141,474,578 N2246S possibly damaging Het
Tac4 T G 11: 95,265,219 I42S possibly damaging Het
Tmem87a A G 2: 120,360,060 V530A Het
Tnrc6c T C 11: 117,749,263 I1208T possibly damaging Het
Vmn1r230 C T 17: 20,847,059 T170I possibly damaging Het
Vps29 A G 5: 122,360,149 D51G probably benign Het
Washc2 T C 6: 116,254,438 L874P probably damaging Het
Wdr5b T C 16: 36,041,556 L15P probably benign Het
Zscan20 T A 4: 128,586,054 Q881H probably damaging Het
Zscan20 T G 4: 128,586,055 Q881P probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7715:Epg5 UTSW 18 77968586 missense probably damaging 1.00
R7753:Epg5 UTSW 18 77948345 missense possibly damaging 0.92
R7981:Epg5 UTSW 18 78009714 critical splice donor site probably null
R8114:Epg5 UTSW 18 78030150 missense probably benign 0.41
R8124:Epg5 UTSW 18 77964996 missense probably benign 0.05
R8307:Epg5 UTSW 18 78022679 missense probably damaging 1.00
R8458:Epg5 UTSW 18 77948731 missense probably benign 0.00
R8751:Epg5 UTSW 18 77965008 missense probably benign 0.07
R8751:Epg5 UTSW 18 77965009 missense possibly damaging 0.65
R8751:Epg5 UTSW 18 77965010 missense probably benign 0.28
R8888:Epg5 UTSW 18 78012871 missense possibly damaging 0.76
R9045:Epg5 UTSW 18 77948799 missense probably damaging 1.00
R9291:Epg5 UTSW 18 78012850 nonsense probably null
R9327:Epg5 UTSW 18 77948220 missense probably benign 0.00
R9365:Epg5 UTSW 18 77954742 missense probably damaging 1.00
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGAGACAGTCCAGCTTG -3'
(R):5'- TAGTCAGTTAAATGGGCGGG -3'

Sequencing Primer
(F):5'- AACTGAGACAGTCCAGCTTGTATCTC -3'
(R):5'- TTGTACCCCTCTCTACAAACTCAGAG -3'
Posted On 2021-10-11