Incidental Mutation 'R8972:Ccdc187'
ID 683143
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8972 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 26243469-26294557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26281067 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 466 (D466E)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect probably benign
Transcript: ENSMUST00000057224
AA Change: D466E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: D466E

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: D466E
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: D505E
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,328,138 S3106F probably damaging Het
Acss1 G T 2: 150,642,889 R145S probably damaging Het
Acss3 T C 10: 107,084,922 Y109C probably damaging Het
Adgre4 G T 17: 55,802,189 G399C probably damaging Het
Alpk1 A G 3: 127,679,583 S924P probably damaging Het
Anapc4 T A 5: 52,850,542 D382E possibly damaging Het
Arfgef2 C T 2: 166,867,333 A1110V possibly damaging Het
Arhgap20 T C 9: 51,849,011 F721L probably benign Het
Arhgef39 T C 4: 43,497,185 S269G probably benign Het
Asap2 C T 12: 21,229,248 T377M probably damaging Het
Baiap3 G T 17: 25,247,036 A558E probably benign Het
Birc6 A C 17: 74,702,318 T4862P probably benign Het
Cc2d2a A G 5: 43,710,542 T843A probably benign Het
Ccdc88a T G 11: 29,485,888 N1270K probably benign Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Cntn1 T G 15: 92,252,397 Y371D probably benign Het
Cpsf1 T C 15: 76,597,328 D1141G probably damaging Het
Crebbp C T 16: 4,108,071 V1193I probably benign Het
Csf2ra A T 19: 61,225,159 S371T probably null Het
Csf2rb2 T C 15: 78,287,915 N432D probably benign Het
Cul9 A T 17: 46,543,251 L175Q probably damaging Het
D10Jhu81e T C 10: 78,167,489 I110V possibly damaging Het
Dlc1 T A 8: 36,938,240 R132* probably null Het
Dock5 C A 14: 67,776,300 L1324F probably damaging Het
Dopey1 T C 9: 86,521,247 V36A possibly damaging Het
Fap A G 2: 62,548,583 V158A probably benign Het
G2e3 T A 12: 51,363,494 S319T possibly damaging Het
Gphn T C 12: 78,609,239 probably null Het
Gucy2g A G 19: 55,237,974 I170T probably benign Het
Hmgxb4 T A 8: 75,021,838 W438R probably damaging Het
Igkv14-126 G T 6: 67,896,345 G19V probably damaging Het
Kansl1l C T 1: 66,772,942 C506Y probably damaging Het
Kif2a T C 13: 106,979,035 T321A probably damaging Het
Krtap6-5 C T 16: 89,047,719 R42H unknown Het
Map4 T A 9: 110,035,117 M470K probably benign Het
Mill1 T C 7: 18,263,057 V191A probably benign Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mkln1 A T 6: 31,496,746 H669L probably damaging Het
Mrgprb3 A T 7: 48,643,674 V43E possibly damaging Het
Mucl2 T A 15: 103,897,594 probably null Het
Mybbp1a T A 11: 72,446,250 I604N probably benign Het
Myo18b T C 5: 112,693,298 T2210A probably benign Het
Nlrp4f T C 13: 65,182,935 I881M probably benign Het
Obscn C A 11: 59,052,616 A4236S probably benign Het
Olfr1200 A C 2: 88,768,286 F10V possibly damaging Het
Olfr26 A G 9: 38,855,958 K299E probably damaging Het
Olfr537-ps1 A T 7: 140,539,125 M203L unknown Het
Olfr926 G A 9: 38,877,854 R226H probably benign Het
Phc3 T A 3: 30,961,777 Q83L possibly damaging Het
Pira2 T C 7: 3,842,071 Y396C probably damaging Het
Prss3 T A 6: 41,376,938 I24F probably damaging Het
Psg21 T C 7: 18,647,368 N417D probably benign Het
Ros1 G T 10: 52,123,237 R1206S probably benign Het
Smg9 A T 7: 24,420,630 Q386L probably benign Het
Sncb T A 13: 54,759,959 probably null Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sorl1 T A 9: 42,046,552 I599F probably damaging Het
Sox6 C A 7: 115,476,983 E807* probably null Het
Ssu2 G A 6: 112,383,937 A53V probably benign Het
Tas2r123 T C 6: 132,847,370 C77R probably benign Het
Tcta T C 9: 108,304,134 R117G unknown Het
Tiam1 G A 16: 89,813,006 A1038V probably damaging Het
Tram2 A T 1: 21,004,049 probably benign Het
Tsku C A 7: 98,352,497 R209L probably damaging Het
Twnk T C 19: 45,011,710 F622L probably damaging Het
Ube2t C T 1: 134,971,932 T106I probably damaging Het
Usf1 C T 1: 171,417,784 R255W probably damaging Het
Usp28 T A 9: 49,037,824 L906Q probably null Het
Vmn2r31 T A 7: 7,396,655 Y101F probably benign Het
Vmn2r42 A G 7: 8,184,332 S814P probably damaging Het
Wnt2b T C 3: 104,951,159 R265G possibly damaging Het
Zfp62 T G 11: 49,216,065 S328A possibly damaging Het
Zfp974 T C 7: 27,911,164 I379V probably benign Het
Zmynd15 T C 11: 70,464,239 V484A possibly damaging Het
Zzef1 T C 11: 72,900,673 L2201P probably damaging Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26280618 missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26281536 missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26293802 missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26275565 missense possibly damaging 0.61
R8694:Ccdc187 UTSW 2 26275493 missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26280514 missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26275565 missense probably benign 0.02
R9214:Ccdc187 UTSW 2 26293397 missense probably benign 0.19
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTTTTGCCCTTGCTGGAGG -3'
(R):5'- AAGAAAGCCTTGGCTGAGCAC -3'

Sequencing Primer
(F):5'- GGACTGGACCTCTGCACAAAAG -3'
(R):5'- TGAGCACGAGTCTTGTCCAC -3'
Posted On 2021-10-11