Incidental Mutation 'R8972:Mkln1'
ID 683156
Institutional Source Beutler Lab
Gene Symbol Mkln1
Ensembl Gene ENSMUSG00000025609
Gene Name muskelin 1, intracellular mediator containing kelch motifs
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R8972 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 31398735-31516811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31496746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 669 (H669L)
Ref Sequence ENSEMBL: ENSMUSP00000026699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026699] [ENSMUST00000130108]
AlphaFold O89050
PDB Structure The crystal structure of discoidin domain from muskelin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026699
AA Change: H669L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026699
Gene: ENSMUSG00000025609
AA Change: H669L

DomainStartEndE-ValueType
Pfam:F5_F8_type_C 20 150 5.8e-11 PFAM
LisH 172 204 4.68e-3 SMART
CTLH 206 258 5.29e-2 SMART
Pfam:Kelch_4 270 324 5.8e-7 PFAM
Pfam:Kelch_1 279 315 2.2e-8 PFAM
Pfam:Kelch_3 282 334 7.6e-13 PFAM
Pfam:Kelch_1 459 498 2.8e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130108
AA Change: H141L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123048
Gene: ENSMUSG00000025609
AA Change: H141L

DomainStartEndE-ValueType
SCOP:d1k3ia3 1 93 8e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal high-frequency ripple oscillation associated with GABA receptor internalization, intracellular trafficking, and degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,328,138 S3106F probably damaging Het
Acss1 G T 2: 150,642,889 R145S probably damaging Het
Acss3 T C 10: 107,084,922 Y109C probably damaging Het
Adgre4 G T 17: 55,802,189 G399C probably damaging Het
Alpk1 A G 3: 127,679,583 S924P probably damaging Het
Anapc4 T A 5: 52,850,542 D382E possibly damaging Het
Arfgef2 C T 2: 166,867,333 A1110V possibly damaging Het
Arhgap20 T C 9: 51,849,011 F721L probably benign Het
Arhgef39 T C 4: 43,497,185 S269G probably benign Het
Asap2 C T 12: 21,229,248 T377M probably damaging Het
Baiap3 G T 17: 25,247,036 A558E probably benign Het
Birc6 A C 17: 74,702,318 T4862P probably benign Het
Cc2d2a A G 5: 43,710,542 T843A probably benign Het
Ccdc187 A T 2: 26,281,067 D466E probably benign Het
Ccdc88a T G 11: 29,485,888 N1270K probably benign Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Cntn1 T G 15: 92,252,397 Y371D probably benign Het
Cpsf1 T C 15: 76,597,328 D1141G probably damaging Het
Crebbp C T 16: 4,108,071 V1193I probably benign Het
Csf2ra A T 19: 61,225,159 S371T probably null Het
Csf2rb2 T C 15: 78,287,915 N432D probably benign Het
Cul9 A T 17: 46,543,251 L175Q probably damaging Het
D10Jhu81e T C 10: 78,167,489 I110V possibly damaging Het
Dlc1 T A 8: 36,938,240 R132* probably null Het
Dock5 C A 14: 67,776,300 L1324F probably damaging Het
Dopey1 T C 9: 86,521,247 V36A possibly damaging Het
Fap A G 2: 62,548,583 V158A probably benign Het
G2e3 T A 12: 51,363,494 S319T possibly damaging Het
Gphn T C 12: 78,609,239 probably null Het
Gucy2g A G 19: 55,237,974 I170T probably benign Het
Hmgxb4 T A 8: 75,021,838 W438R probably damaging Het
Igkv14-126 G T 6: 67,896,345 G19V probably damaging Het
Kansl1l C T 1: 66,772,942 C506Y probably damaging Het
Kif2a T C 13: 106,979,035 T321A probably damaging Het
Krtap6-5 C T 16: 89,047,719 R42H unknown Het
Map4 T A 9: 110,035,117 M470K probably benign Het
Mill1 T C 7: 18,263,057 V191A probably benign Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mrgprb3 A T 7: 48,643,674 V43E possibly damaging Het
Mucl2 T A 15: 103,897,594 probably null Het
Mybbp1a T A 11: 72,446,250 I604N probably benign Het
Myo18b T C 5: 112,693,298 T2210A probably benign Het
Nlrp4f T C 13: 65,182,935 I881M probably benign Het
Obscn C A 11: 59,052,616 A4236S probably benign Het
Olfr1200 A C 2: 88,768,286 F10V possibly damaging Het
Olfr26 A G 9: 38,855,958 K299E probably damaging Het
Olfr537-ps1 A T 7: 140,539,125 M203L unknown Het
Olfr926 G A 9: 38,877,854 R226H probably benign Het
Phc3 T A 3: 30,961,777 Q83L possibly damaging Het
Pira2 T C 7: 3,842,071 Y396C probably damaging Het
Prss3 T A 6: 41,376,938 I24F probably damaging Het
Psg21 T C 7: 18,647,368 N417D probably benign Het
Ros1 G T 10: 52,123,237 R1206S probably benign Het
Smg9 A T 7: 24,420,630 Q386L probably benign Het
Sncb T A 13: 54,759,959 probably null Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sorl1 T A 9: 42,046,552 I599F probably damaging Het
Sox6 C A 7: 115,476,983 E807* probably null Het
Ssu2 G A 6: 112,383,937 A53V probably benign Het
Tas2r123 T C 6: 132,847,370 C77R probably benign Het
Tcta T C 9: 108,304,134 R117G unknown Het
Tiam1 G A 16: 89,813,006 A1038V probably damaging Het
Tram2 A T 1: 21,004,049 probably benign Het
Tsku C A 7: 98,352,497 R209L probably damaging Het
Twnk T C 19: 45,011,710 F622L probably damaging Het
Ube2t C T 1: 134,971,932 T106I probably damaging Het
Usf1 C T 1: 171,417,784 R255W probably damaging Het
Usp28 T A 9: 49,037,824 L906Q probably null Het
Vmn2r31 T A 7: 7,396,655 Y101F probably benign Het
Vmn2r42 A G 7: 8,184,332 S814P probably damaging Het
Wnt2b T C 3: 104,951,159 R265G possibly damaging Het
Zfp62 T G 11: 49,216,065 S328A possibly damaging Het
Zfp974 T C 7: 27,911,164 I379V probably benign Het
Zmynd15 T C 11: 70,464,239 V484A possibly damaging Het
Zzef1 T C 11: 72,900,673 L2201P probably damaging Het
Other mutations in Mkln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Mkln1 APN 6 31432990 missense probably damaging 0.99
IGL01569:Mkln1 APN 6 31428128 splice site probably benign
IGL01882:Mkln1 APN 6 31451534 missense probably benign
IGL02009:Mkln1 APN 6 31449520 missense probably benign 0.02
IGL02160:Mkln1 APN 6 31492791 splice site probably benign
IGL02994:Mkln1 APN 6 31490443 missense probably damaging 1.00
IGL03105:Mkln1 APN 6 31459059 nonsense probably null
PIT4377001:Mkln1 UTSW 6 31474354 missense probably damaging 1.00
R0376:Mkln1 UTSW 6 31478018 missense probably benign 0.00
R0446:Mkln1 UTSW 6 31449504 missense probably damaging 0.98
R0518:Mkln1 UTSW 6 31468132 missense probably benign 0.00
R0600:Mkln1 UTSW 6 31432927 splice site probably benign
R1066:Mkln1 UTSW 6 31418987 missense possibly damaging 0.85
R1248:Mkln1 UTSW 6 31489368 missense probably damaging 1.00
R1717:Mkln1 UTSW 6 31507644 missense probably benign
R1921:Mkln1 UTSW 6 31428178 missense probably benign 0.22
R1978:Mkln1 UTSW 6 31490530 nonsense probably null
R3836:Mkln1 UTSW 6 31468336 missense probably damaging 1.00
R3895:Mkln1 UTSW 6 31507667 missense probably damaging 1.00
R4456:Mkln1 UTSW 6 31426772 missense probably damaging 1.00
R4513:Mkln1 UTSW 6 31433158 intron probably benign
R4737:Mkln1 UTSW 6 31426799 missense probably damaging 1.00
R4819:Mkln1 UTSW 6 31474486 missense probably benign 0.00
R4960:Mkln1 UTSW 6 31459006 missense probably damaging 1.00
R5291:Mkln1 UTSW 6 31490481 missense possibly damaging 0.78
R5364:Mkln1 UTSW 6 31496712 missense probably damaging 1.00
R5739:Mkln1 UTSW 6 31496702 missense probably benign 0.00
R5797:Mkln1 UTSW 6 31433069 missense probably benign 0.21
R5890:Mkln1 UTSW 6 31490547 missense probably benign 0.02
R5940:Mkln1 UTSW 6 31489372 missense probably damaging 1.00
R6132:Mkln1 UTSW 6 31431220 missense probably damaging 0.98
R6521:Mkln1 UTSW 6 31490544 missense probably damaging 1.00
R7362:Mkln1 UTSW 6 31468168 missense probably benign 0.31
R7711:Mkln1 UTSW 6 31492649 missense probably damaging 0.99
R8094:Mkln1 UTSW 6 31492653 nonsense probably null
R8340:Mkln1 UTSW 6 31432943 missense possibly damaging 0.53
R8379:Mkln1 UTSW 6 31458965 nonsense probably null
R9403:Mkln1 UTSW 6 31432970 missense not run
Z1176:Mkln1 UTSW 6 31398921 missense possibly damaging 0.74
Z1176:Mkln1 UTSW 6 31451554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACGCTCTTACTCTGGATGC -3'
(R):5'- TCCCCTCAGATAGATGGTGTAATG -3'

Sequencing Primer
(F):5'- GCTCTTACTCTGGATGCTCAAAAAC -3'
(R):5'- GAGATACCTTGTCATTTCGGCTAGC -3'
Posted On 2021-10-11