Incidental Mutation 'R0131:Htr1f'
ID 68319
Institutional Source Beutler Lab
Gene Symbol Htr1f
Ensembl Gene ENSMUSG00000050783
Gene Name 5-hydroxytryptamine (serotonin) receptor 1F
Synonyms Htr1eb
MMRRC Submission 038416-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0131 (G1)
Quality Score 136
Status Validated
Chromosome 16
Chromosomal Location 64745092-64926147 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64747091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000063136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063076]
AlphaFold Q02284
Predicted Effect probably damaging
Transcript: ENSMUST00000063076
AA Change: V67A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063136
Gene: ENSMUSG00000050783
AA Change: V67A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 32 230 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 34 362 2.4e-10 PFAM
Pfam:7tm_1 40 347 4.1e-74 PFAM
Pfam:7TM_GPCR_Srv 54 249 5.2e-7 PFAM
Meta Mutation Damage Score 0.3621 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display decreased temperature sensitivity and physiological abnormalities in nerve fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 87,258,197 (GRCm39) I773T probably benign Het
Adamtsl1 T A 4: 86,260,960 (GRCm39) I1057N possibly damaging Het
Anxa5 G A 3: 36,504,821 (GRCm39) A247V probably damaging Het
Ascc3 T G 10: 50,611,425 (GRCm39) W1589G probably damaging Het
Atp2b2 G A 6: 113,770,743 (GRCm39) P389S probably damaging Het
Bpifa6 T A 2: 153,824,851 (GRCm39) S9T probably benign Het
Cfhr4 T A 1: 139,682,009 (GRCm39) T196S probably damaging Het
Chd8 A G 14: 52,442,783 (GRCm39) V589A probably benign Het
Chrnb2 T C 3: 89,671,713 (GRCm39) M1V probably null Het
Col16a1 T A 4: 129,960,889 (GRCm39) V449E unknown Het
Cttnbp2nl T G 3: 104,913,173 (GRCm39) K237T probably damaging Het
Dazap1 T G 10: 80,114,060 (GRCm39) probably null Het
Fam187b T A 7: 30,688,545 (GRCm39) V22E probably damaging Het
Fat2 A T 11: 55,164,037 (GRCm39) S3073T probably benign Het
Fcgbpl1 A G 7: 27,837,040 (GRCm39) R320G probably damaging Het
Gm16069 T C 3: 89,088,232 (GRCm39) probably benign Het
H2-T24 T A 17: 36,325,878 (GRCm39) I238F probably damaging Het
Hectd4 A G 5: 121,471,087 (GRCm39) E2658G probably benign Het
Herc1 A C 9: 66,388,192 (GRCm39) I3826L probably benign Het
Hinfp A G 9: 44,211,060 (GRCm39) C67R probably damaging Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Hspg2 T C 4: 137,279,198 (GRCm39) Y3094H probably damaging Het
Iqcc T G 4: 129,510,392 (GRCm39) E374D probably damaging Het
Kcnj9 T C 1: 172,153,765 (GRCm39) T120A probably damaging Het
Kif3a A G 11: 53,477,743 (GRCm39) K404R possibly damaging Het
Kitl C T 10: 99,923,226 (GRCm39) P208S probably benign Het
Lpcat4 A G 2: 112,077,093 (GRCm39) Y479C probably damaging Het
Lrrc74b T C 16: 17,371,016 (GRCm39) N227S probably damaging Het
Mdc1 T A 17: 36,163,473 (GRCm39) V1007D probably damaging Het
Mocos T G 18: 24,812,819 (GRCm39) I571S probably benign Het
Myh8 A G 11: 67,183,014 (GRCm39) N659D probably damaging Het
Naip2 A G 13: 100,320,296 (GRCm39) V240A probably benign Het
Nap1l1 T C 10: 111,321,370 (GRCm39) S37P probably benign Het
Nin T G 12: 70,097,915 (GRCm39) K515T probably damaging Het
Npl T A 1: 153,384,864 (GRCm39) K258* probably null Het
Ntn4 T A 10: 93,480,569 (GRCm39) S98T possibly damaging Het
Or10x1 T C 1: 174,197,152 (GRCm39) V223A probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5k14 C A 16: 58,693,269 (GRCm39) M81I probably benign Het
Or8u10 T C 2: 85,915,844 (GRCm39) I92M probably damaging Het
Pkp2 T C 16: 16,058,577 (GRCm39) probably benign Het
Ppox C A 1: 171,106,849 (GRCm39) A192S possibly damaging Het
Prkdc T C 16: 15,531,517 (GRCm39) L1380S probably benign Het
Psd4 C A 2: 24,295,363 (GRCm39) A839E probably damaging Het
Ptprn2 T G 12: 116,685,711 (GRCm39) F57V probably damaging Het
Ptprt C T 2: 162,120,030 (GRCm39) V146I probably benign Het
R3hdm2 T A 10: 127,334,322 (GRCm39) M915K probably damaging Het
Rab26 C T 17: 24,749,759 (GRCm39) probably null Het
Rnf213 A G 11: 119,321,187 (GRCm39) E1215G probably benign Het
Rprd2 T C 3: 95,681,673 (GRCm39) K407E probably damaging Het
Siah3 G A 14: 75,693,574 (GRCm39) V27I possibly damaging Het
Slc14a2 T A 18: 78,235,338 (GRCm39) N280Y probably damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc25a35 A G 11: 68,862,786 (GRCm39) Y247C probably damaging Het
Slc29a4 A G 5: 142,691,285 (GRCm39) D55G probably benign Het
Slc35d1 C T 4: 103,065,378 (GRCm39) V189I probably benign Het
Srrm1 G A 4: 135,067,884 (GRCm39) R322* probably null Het
Stac3 A T 10: 127,339,519 (GRCm39) R138S probably damaging Het
Tbc1d9b T C 11: 50,026,751 (GRCm39) I73T probably benign Het
Tgtp1 A G 11: 48,878,159 (GRCm39) F182S probably benign Het
Tmcc3 T C 10: 94,381,437 (GRCm39) probably benign Het
Tmem116 A G 5: 121,631,845 (GRCm39) probably benign Het
Tmem260 T A 14: 48,720,779 (GRCm39) C306* probably null Het
Tspyl1 A G 10: 34,159,085 (GRCm39) N270S probably damaging Het
Tusc1 A T 4: 93,223,070 (GRCm39) H196Q probably benign Het
Ugt2a1 T A 5: 87,622,720 (GRCm39) K293* probably null Het
Vmn2r102 A C 17: 19,899,025 (GRCm39) T456P probably benign Het
Vmn2r90 T A 17: 17,932,511 (GRCm39) S139R probably benign Het
Zfp879 C A 11: 50,724,426 (GRCm39) G210V probably damaging Het
Zmym2 A G 14: 57,180,715 (GRCm39) N876D probably benign Het
Other mutations in Htr1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Htr1f APN 16 64,746,469 (GRCm39) missense probably benign 0.00
IGL01134:Htr1f APN 16 64,746,501 (GRCm39) missense probably benign 0.00
IGL01455:Htr1f APN 16 64,746,385 (GRCm39) missense probably damaging 1.00
IGL01580:Htr1f APN 16 64,746,198 (GRCm39) nonsense probably null
IGL01865:Htr1f APN 16 64,746,282 (GRCm39) missense probably damaging 1.00
IGL02027:Htr1f APN 16 64,746,684 (GRCm39) nonsense probably null
IGL02234:Htr1f APN 16 64,746,430 (GRCm39) missense probably damaging 1.00
IGL02567:Htr1f APN 16 64,746,611 (GRCm39) missense probably benign 0.45
R0035:Htr1f UTSW 16 64,746,860 (GRCm39) missense probably damaging 1.00
R0131:Htr1f UTSW 16 64,747,091 (GRCm39) missense probably damaging 1.00
R0132:Htr1f UTSW 16 64,747,091 (GRCm39) missense probably damaging 1.00
R0193:Htr1f UTSW 16 64,747,112 (GRCm39) missense probably damaging 1.00
R0523:Htr1f UTSW 16 64,746,262 (GRCm39) missense probably damaging 1.00
R0722:Htr1f UTSW 16 64,746,254 (GRCm39) missense probably damaging 0.99
R2055:Htr1f UTSW 16 64,746,398 (GRCm39) missense probably damaging 1.00
R3418:Htr1f UTSW 16 64,746,260 (GRCm39) missense probably damaging 1.00
R4090:Htr1f UTSW 16 64,746,324 (GRCm39) missense probably benign 0.06
R4320:Htr1f UTSW 16 64,747,050 (GRCm39) missense possibly damaging 0.87
R5037:Htr1f UTSW 16 64,746,291 (GRCm39) missense probably damaging 1.00
R6004:Htr1f UTSW 16 64,746,239 (GRCm39) missense probably damaging 1.00
R7383:Htr1f UTSW 16 64,747,206 (GRCm39) missense probably benign 0.00
R7462:Htr1f UTSW 16 64,746,383 (GRCm39) missense probably damaging 0.99
R7864:Htr1f UTSW 16 64,747,157 (GRCm39) missense probably damaging 1.00
R8677:Htr1f UTSW 16 64,746,414 (GRCm39) missense possibly damaging 0.69
R8816:Htr1f UTSW 16 64,746,537 (GRCm39) missense probably benign 0.05
R8836:Htr1f UTSW 16 64,747,196 (GRCm39) missense probably benign
R9106:Htr1f UTSW 16 64,746,637 (GRCm39) missense probably damaging 1.00
R9155:Htr1f UTSW 16 64,746,788 (GRCm39) missense probably benign 0.00
R9182:Htr1f UTSW 16 64,746,825 (GRCm39) missense probably benign 0.03
R9244:Htr1f UTSW 16 64,746,857 (GRCm39) missense probably benign 0.31
R9430:Htr1f UTSW 16 64,746,831 (GRCm39) missense probably damaging 1.00
Z1176:Htr1f UTSW 16 64,747,237 (GRCm39) missense probably benign
Z1176:Htr1f UTSW 16 64,746,440 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGACTTGACCGTTCAGCTCCTCC -3'
(R):5'- TGAGGAACTGTTAAACCGAATGCCATC -3'

Sequencing Primer
(F):5'- CAACTGCATCTGTGATGGC -3'
(R):5'- GAATGCCATCCAAAATTCTGGTATCC -3'
Posted On 2013-09-03