Incidental Mutation 'R8972:Dock5'
ID 683199
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms 1110060D06Rik, rlc, lr2
MMRRC Submission 068806-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.346) question?
Stock # R8972 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 67989584-68170891 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 68013749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1324 (L1324F)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably damaging
Transcript: ENSMUST00000039135
AA Change: L1324F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: L1324F

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,278,138 (GRCm39) S3106F probably damaging Het
Acss1 G T 2: 150,484,809 (GRCm39) R145S probably damaging Het
Acss3 T C 10: 106,920,783 (GRCm39) Y109C probably damaging Het
Adgre4 G T 17: 56,109,189 (GRCm39) G399C probably damaging Het
Alpk1 A G 3: 127,473,232 (GRCm39) S924P probably damaging Het
Anapc4 T A 5: 53,007,884 (GRCm39) D382E possibly damaging Het
Arfgef2 C T 2: 166,709,253 (GRCm39) A1110V possibly damaging Het
Arhgap20 T C 9: 51,760,311 (GRCm39) F721L probably benign Het
Arhgef39 T C 4: 43,497,185 (GRCm39) S269G probably benign Het
Asap2 C T 12: 21,279,249 (GRCm39) T377M probably damaging Het
Baiap3 G T 17: 25,466,010 (GRCm39) A558E probably benign Het
Birc6 A C 17: 75,009,313 (GRCm39) T4862P probably benign Het
Cc2d2a A G 5: 43,867,884 (GRCm39) T843A probably benign Het
Ccdc187 A T 2: 26,171,079 (GRCm39) D466E probably benign Het
Ccdc88a T G 11: 29,435,888 (GRCm39) N1270K probably benign Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Cntn1 T G 15: 92,150,278 (GRCm39) Y371D probably benign Het
Cpsf1 T C 15: 76,481,528 (GRCm39) D1141G probably damaging Het
Crebbp C T 16: 3,925,935 (GRCm39) V1193I probably benign Het
Csf2ra A T 19: 61,213,597 (GRCm39) S371T probably null Het
Csf2rb2 T C 15: 78,172,115 (GRCm39) N432D probably benign Het
Cul9 A T 17: 46,854,177 (GRCm39) L175Q probably damaging Het
Dlc1 T A 8: 37,405,394 (GRCm39) R132* probably null Het
Dop1a T C 9: 86,403,300 (GRCm39) V36A possibly damaging Het
Fap A G 2: 62,378,927 (GRCm39) V158A probably benign Het
G2e3 T A 12: 51,410,277 (GRCm39) S319T possibly damaging Het
Gatd3a T C 10: 78,003,323 (GRCm39) I110V possibly damaging Het
Gphn T C 12: 78,656,013 (GRCm39) probably null Het
Gucy2g A G 19: 55,226,406 (GRCm39) I170T probably benign Het
Hmgxb4 T A 8: 75,748,466 (GRCm39) W438R probably damaging Het
Igkv14-126 G T 6: 67,873,329 (GRCm39) G19V probably damaging Het
Kansl1l C T 1: 66,812,101 (GRCm39) C506Y probably damaging Het
Kif2a T C 13: 107,115,543 (GRCm39) T321A probably damaging Het
Krtap6-5 C T 16: 88,844,607 (GRCm39) R42H unknown Het
Map4 T A 9: 109,864,185 (GRCm39) M470K probably benign Het
Mill1 T C 7: 17,996,982 (GRCm39) V191A probably benign Het
Mki67 C A 7: 135,297,364 (GRCm39) A2557S possibly damaging Het
Mkln1 A T 6: 31,473,681 (GRCm39) H669L probably damaging Het
Mrgprb3 A T 7: 48,293,422 (GRCm39) V43E possibly damaging Het
Mucl2 T A 15: 103,927,860 (GRCm39) probably null Het
Mybbp1a T A 11: 72,337,076 (GRCm39) I604N probably benign Het
Myo18b T C 5: 112,841,164 (GRCm39) T2210A probably benign Het
Nlrp4f T C 13: 65,330,749 (GRCm39) I881M probably benign Het
Obscn C A 11: 58,943,442 (GRCm39) A4236S probably benign Het
Or13a23-ps1 A T 7: 140,119,038 (GRCm39) M203L unknown Het
Or4a67 A C 2: 88,598,630 (GRCm39) F10V possibly damaging Het
Or8d1 A G 9: 38,767,254 (GRCm39) K299E probably damaging Het
Or8d2b G A 9: 38,789,150 (GRCm39) R226H probably benign Het
Phc3 T A 3: 31,015,926 (GRCm39) Q83L possibly damaging Het
Pira2 T C 7: 3,845,070 (GRCm39) Y396C probably damaging Het
Prss3 T A 6: 41,353,872 (GRCm39) I24F probably damaging Het
Psg21 T C 7: 18,381,293 (GRCm39) N417D probably benign Het
Ros1 G T 10: 51,999,333 (GRCm39) R1206S probably benign Het
Smg9 A T 7: 24,120,055 (GRCm39) Q386L probably benign Het
Sncb T A 13: 54,907,772 (GRCm39) probably null Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Sorl1 T A 9: 41,957,848 (GRCm39) I599F probably damaging Het
Sox6 C A 7: 115,076,218 (GRCm39) E807* probably null Het
Ssu2 G A 6: 112,360,898 (GRCm39) A53V probably benign Het
Tas2r123 T C 6: 132,824,333 (GRCm39) C77R probably benign Het
Tcta T C 9: 108,181,333 (GRCm39) R117G unknown Het
Tiam1 G A 16: 89,609,894 (GRCm39) A1038V probably damaging Het
Tram2 A T 1: 21,074,273 (GRCm39) probably benign Het
Tsku C A 7: 98,001,704 (GRCm39) R209L probably damaging Het
Twnk T C 19: 45,000,149 (GRCm39) F622L probably damaging Het
Ube2t C T 1: 134,899,670 (GRCm39) T106I probably damaging Het
Usf1 C T 1: 171,245,352 (GRCm39) R255W probably damaging Het
Usp28 T A 9: 48,949,124 (GRCm39) L906Q probably null Het
Vmn2r31 T A 7: 7,399,654 (GRCm39) Y101F probably benign Het
Vmn2r42 A G 7: 8,187,331 (GRCm39) S814P probably damaging Het
Wnt2b T C 3: 104,858,475 (GRCm39) R265G possibly damaging Het
Zfp62 T G 11: 49,106,892 (GRCm39) S328A possibly damaging Het
Zfp974 T C 7: 27,610,589 (GRCm39) I379V probably benign Het
Zmynd15 T C 11: 70,355,065 (GRCm39) V484A possibly damaging Het
Zzef1 T C 11: 72,791,499 (GRCm39) L2201P probably damaging Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 68,024,338 (GRCm39) splice site probably benign
IGL00930:Dock5 APN 14 68,008,526 (GRCm39) missense probably damaging 1.00
IGL01525:Dock5 APN 14 68,043,169 (GRCm39) splice site probably benign
IGL01759:Dock5 APN 14 68,118,708 (GRCm39) nonsense probably null
IGL01941:Dock5 APN 14 68,049,681 (GRCm39) missense probably damaging 1.00
IGL02025:Dock5 APN 14 68,000,736 (GRCm39) missense probably damaging 1.00
IGL02093:Dock5 APN 14 68,076,992 (GRCm39) splice site probably benign
IGL02179:Dock5 APN 14 68,043,945 (GRCm39) splice site probably benign
IGL02208:Dock5 APN 14 68,065,899 (GRCm39) missense probably benign 0.06
IGL02605:Dock5 APN 14 68,065,887 (GRCm39) missense probably benign 0.18
IGL02608:Dock5 APN 14 68,065,888 (GRCm39) missense probably benign 0.01
IGL02938:Dock5 APN 14 67,994,667 (GRCm39) splice site probably benign
IGL02971:Dock5 APN 14 67,994,558 (GRCm39) missense probably null 1.00
IGL02983:Dock5 APN 14 68,002,119 (GRCm39) missense probably damaging 1.00
IGL03151:Dock5 APN 14 68,103,516 (GRCm39) missense probably damaging 1.00
IGL03410:Dock5 APN 14 68,083,535 (GRCm39) missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 68,062,123 (GRCm39) missense possibly damaging 0.83
R0026:Dock5 UTSW 14 68,083,530 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0112:Dock5 UTSW 14 68,057,090 (GRCm39) missense probably benign
R0127:Dock5 UTSW 14 68,083,491 (GRCm39) missense probably benign 0.13
R0144:Dock5 UTSW 14 68,023,735 (GRCm39) missense probably benign 0.18
R0312:Dock5 UTSW 14 68,033,440 (GRCm39) missense possibly damaging 0.82
R0360:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0364:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0496:Dock5 UTSW 14 68,054,967 (GRCm39) missense probably damaging 1.00
R0506:Dock5 UTSW 14 68,022,241 (GRCm39) splice site probably benign
R0586:Dock5 UTSW 14 68,046,481 (GRCm39) missense probably damaging 1.00
R0597:Dock5 UTSW 14 68,022,383 (GRCm39) splice site probably null
R0625:Dock5 UTSW 14 68,078,612 (GRCm39) missense probably benign
R1109:Dock5 UTSW 14 68,043,927 (GRCm39) missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67,996,610 (GRCm39) missense probably benign 0.00
R1278:Dock5 UTSW 14 68,077,015 (GRCm39) missense possibly damaging 0.80
R1927:Dock5 UTSW 14 68,083,511 (GRCm39) missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67,994,584 (GRCm39) nonsense probably null
R1946:Dock5 UTSW 14 68,023,765 (GRCm39) missense probably damaging 1.00
R2046:Dock5 UTSW 14 68,049,591 (GRCm39) missense probably benign
R2101:Dock5 UTSW 14 68,031,459 (GRCm39) missense probably benign 0.02
R2252:Dock5 UTSW 14 68,022,261 (GRCm39) missense probably damaging 0.98
R2882:Dock5 UTSW 14 68,077,069 (GRCm39) missense probably damaging 0.99
R3110:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R3112:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67,993,941 (GRCm39) missense probably benign 0.02
R4242:Dock5 UTSW 14 68,065,939 (GRCm39) missense probably benign 0.19
R4244:Dock5 UTSW 14 68,012,031 (GRCm39) missense probably benign 0.41
R4646:Dock5 UTSW 14 68,080,228 (GRCm39) missense probably benign 0.01
R4793:Dock5 UTSW 14 68,037,803 (GRCm39) missense probably benign 0.26
R4841:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R4842:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R5159:Dock5 UTSW 14 68,029,738 (GRCm39) missense probably benign 0.04
R5164:Dock5 UTSW 14 68,055,110 (GRCm39) nonsense probably null
R5206:Dock5 UTSW 14 68,000,633 (GRCm39) missense probably benign 0.35
R5207:Dock5 UTSW 14 68,013,733 (GRCm39) missense probably benign 0.06
R5322:Dock5 UTSW 14 68,007,715 (GRCm39) missense probably benign 0.41
R5374:Dock5 UTSW 14 68,043,205 (GRCm39) missense possibly damaging 0.81
R5413:Dock5 UTSW 14 68,002,104 (GRCm39) missense probably damaging 1.00
R5476:Dock5 UTSW 14 68,051,456 (GRCm39) missense possibly damaging 0.92
R5504:Dock5 UTSW 14 68,040,535 (GRCm39) missense probably benign 0.01
R5677:Dock5 UTSW 14 68,015,052 (GRCm39) missense probably benign 0.00
R5773:Dock5 UTSW 14 68,033,507 (GRCm39) missense possibly damaging 0.95
R5845:Dock5 UTSW 14 68,078,550 (GRCm39) missense possibly damaging 0.82
R5957:Dock5 UTSW 14 68,095,443 (GRCm39) missense probably benign
R6154:Dock5 UTSW 14 68,097,361 (GRCm39) missense probably benign 0.03
R6268:Dock5 UTSW 14 68,027,724 (GRCm39) nonsense probably null
R6393:Dock5 UTSW 14 68,060,051 (GRCm39) missense probably benign 0.32
R6512:Dock5 UTSW 14 68,062,097 (GRCm39) missense possibly damaging 0.93
R6759:Dock5 UTSW 14 68,033,445 (GRCm39) missense probably benign 0.00
R7012:Dock5 UTSW 14 68,060,035 (GRCm39) missense probably damaging 1.00
R7061:Dock5 UTSW 14 68,007,703 (GRCm39) missense probably damaging 0.96
R7196:Dock5 UTSW 14 67,993,919 (GRCm39) missense probably damaging 1.00
R7200:Dock5 UTSW 14 68,009,151 (GRCm39) nonsense probably null
R7311:Dock5 UTSW 14 68,065,951 (GRCm39) missense probably benign 0.25
R7359:Dock5 UTSW 14 68,003,337 (GRCm39) missense probably benign 0.10
R7422:Dock5 UTSW 14 68,046,479 (GRCm39) missense probably benign 0.01
R7588:Dock5 UTSW 14 68,000,607 (GRCm39) critical splice donor site probably null
R7637:Dock5 UTSW 14 68,023,789 (GRCm39) missense possibly damaging 0.95
R7709:Dock5 UTSW 14 68,033,454 (GRCm39) missense probably benign 0.44
R7763:Dock5 UTSW 14 68,058,776 (GRCm39) missense probably damaging 0.97
R8044:Dock5 UTSW 14 68,062,141 (GRCm39) missense probably damaging 1.00
R8076:Dock5 UTSW 14 68,040,426 (GRCm39) splice site probably null
R8168:Dock5 UTSW 14 68,007,646 (GRCm39) splice site probably null
R8353:Dock5 UTSW 14 68,054,957 (GRCm39) splice site probably null
R8480:Dock5 UTSW 14 68,073,859 (GRCm39) missense probably benign 0.32
R8535:Dock5 UTSW 14 68,031,425 (GRCm39) missense probably benign 0.19
R8708:Dock5 UTSW 14 68,004,820 (GRCm39) missense probably benign 0.02
R8732:Dock5 UTSW 14 68,083,449 (GRCm39) missense possibly damaging 0.85
R8888:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8895:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8936:Dock5 UTSW 14 68,083,439 (GRCm39) nonsense probably null
R8962:Dock5 UTSW 14 67,994,640 (GRCm39) missense probably benign
R9244:Dock5 UTSW 14 67,996,563 (GRCm39) missense probably damaging 0.99
R9345:Dock5 UTSW 14 68,060,071 (GRCm39) missense possibly damaging 0.74
R9679:Dock5 UTSW 14 68,018,450 (GRCm39) missense probably damaging 1.00
X0023:Dock5 UTSW 14 68,008,537 (GRCm39) missense probably benign 0.15
Z1177:Dock5 UTSW 14 68,051,382 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACAATGGTCAAAGCTTTGGG -3'
(R):5'- ACAAGTCAGGGTCCCTTAAGG -3'

Sequencing Primer
(F):5'- GGTCAAAGCTTTGGGGATTATATATC -3'
(R):5'- CCCTTAAGGATGCTCAGCC -3'
Posted On 2021-10-11