Mutagenetix > Incidental Mutation

Incidental Mutation 'R8973:Nav1'

683218

Institutional Source

Beutler Lab

Gene Symbol

Nav1

Ensembl Gene

ENSMUSG00000009418

Gene Name

neuron navigator 1

Synonyms

steerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.921) question?

Stock #

R8973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135434580-135607295 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135584725 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 199 (D199G)

Ref Sequence

ENSEMBL: ENSMUSP00000140322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]

AlphaFold

Q8CH77

Predicted Effect

probably benign
Transcript: ENSMUST00000040599
AA Change: D199G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: D199G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1070	1105	N/A	INTRINSIC
low complexity region	1179	1210	N/A	INTRINSIC
low complexity region	1260	1281	N/A	INTRINSIC
low complexity region	1296	1304	N/A	INTRINSIC
coiled coil region	1328	1360	N/A	INTRINSIC
AAA	1548	1702	3.16e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067414
AA Change: D199G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: D199G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1070	1105	N/A	INTRINSIC
low complexity region	1179	1210	N/A	INTRINSIC
low complexity region	1260	1281	N/A	INTRINSIC
low complexity region	1296	1304	N/A	INTRINSIC
coiled coil region	1328	1360	N/A	INTRINSIC
AAA	1548	1702	3.16e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190298
AA Change: D199G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: D199G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1013	1048	N/A	INTRINSIC
low complexity region	1122	1153	N/A	INTRINSIC
low complexity region	1200	1221	N/A	INTRINSIC
low complexity region	1236	1244	N/A	INTRINSIC
coiled coil region	1268	1300	N/A	INTRINSIC
AAA	1488	1642	3.16e-5	SMART

Meta Mutation Damage Score

0.0611

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	T	G	18: 57,592,067	L123V	possibly damaging	Het
1810022K09Rik	C	T	3: 14,607,245	V97I	probably benign	Het
2410089E03Rik	T	C	15: 8,203,793	W1201R	probably damaging	Het
4930404N11Rik	T	C	10: 81,364,015	D129G	unknown	Het
Adamts16	A	T	13: 70,738,840	I975N	probably benign	Het
Adcy8	A	G	15: 64,699,135	*1250Q	probably null	Het
Anapc1	A	T	2: 128,664,032	I628N	probably damaging	Het
Ankrd39	C	T	1: 36,539,358		probably benign	Het
Ankub1	A	T	3: 57,665,511	S263R	possibly damaging	Het
Aoah	A	G	13: 20,840,155	I94V	probably benign	Het
Aox2	A	G	1: 58,289,954	D186G	probably benign	Het
Arap2	A	T	5: 62,698,325	C589*	probably null	Het
Armt1	T	C	10: 4,439,550	L69P	probably damaging	Het
Atxn7l3	T	A	11: 102,292,772	Y185F	probably benign	Het
BC067074	A	G	13: 113,319,759	T780A		Het
Cacna2d4	A	G	6: 119,241,181	D159G	probably damaging	Het
Camta2	C	A	11: 70,670,358	R1184L	probably benign	Het
Ccr7	G	A	11: 99,145,823	T91I	probably damaging	Het
Cdh9	A	G	15: 16,831,045	T323A	possibly damaging	Het
Cep250	C	T	2: 155,970,122	A446V	unknown	Het
Clec2e	C	A	6: 129,093,411	G216*	probably null	Het
Col25a1	T	C	3: 130,475,626	S176P	unknown	Het
Col4a3	A	C	1: 82,715,331	I1446L	probably benign	Het
Cse1l	A	G	2: 166,943,080	E823G	probably damaging	Het
Dchs2	A	G	3: 83,354,456	E2677G	possibly damaging	Het
Dis3l	T	C	9: 64,339,542	E77G	probably damaging	Het
Dnah6	T	C	6: 73,144,751	D1416G	probably benign	Het
Dpyd	T	C	3: 119,314,933		probably null	Het
Dst	A	G	1: 34,228,855	D3112G	probably damaging	Het
Dusp13	A	C	14: 21,734,906	N128K	probably benign	Het
Emilin2	T	G	17: 71,275,084	K216Q	probably benign	Het
Enam	T	C	5: 88,494,088	W254R	possibly damaging	Het
Esrrg	A	C	1: 188,198,750	N346T	possibly damaging	Het
Fbn2	C	T	18: 58,153,856	G244R	probably damaging	Het
Fbxw25	A	G	9: 109,650,064	L373P		Het
Gm21060	C	A	19: 61,296,928	V48L	possibly damaging	Het
Gm30302	A	T	13: 49,788,239	D80E	probably benign	Het
Gtpbp3	T	C	8: 71,491,162	V254A	possibly damaging	Het
H2-DMb2	A	G	17: 34,148,725	D171G	probably damaging	Het
Hrg	A	T	16: 22,959,218	T242S	probably benign	Het
Inf2	G	T	12: 112,607,515	C751F	unknown	Het
Krt13	A	T	11: 100,119,438	M239K	possibly damaging	Het
Lrrc72	A	G	12: 36,253,294	S7P	probably benign	Het
Matn2	A	G	15: 34,433,050	I867V	probably benign	Het
Mdh2	C	T	5: 135,790,165	A325V	possibly damaging	Het
Mki67	C	A	7: 135,695,635	A2557S	possibly damaging	Het
Mrpl16	A	T	19: 11,772,943	R64*	probably null	Het
Nbn	T	C	4: 15,986,585	V662A	probably damaging	Het
Nek10	G	A	14: 14,931,321		probably null	Het
Olfr141	C	A	2: 86,806,856	V48F	probably benign	Het
Olfr298	A	G	7: 86,489,279	S91P	probably damaging	Het
Olfr834	C	A	9: 18,988,678	S230*	probably null	Het
Olfr884	T	A	9: 38,047,543	V107D	possibly damaging	Het
Pcsk7	T	G	9: 45,927,642	S617R	probably benign	Het
Pde10a	C	A	17: 8,924,239	Q6K	probably benign	Het
Pigq	A	C	17: 25,932,167	M396R	probably damaging	Het
Pkhd1l1	T	A	15: 44,586,437	D3865E	probably damaging	Het
Prag1	C	T	8: 36,099,590		probably benign	Het
Rint1	A	G	5: 23,811,730	T498A	probably benign	Het
Rnf213	T	A	11: 119,461,930	F3921I		Het
Rpp14	A	G	14: 8,088,768	S95G	probably benign	Het
Ryk	T	G	9: 102,861,921	Y78D	possibly damaging	Het
Sez6	A	T	11: 77,974,571	Q678L	probably damaging	Het
Slc22a21	T	C	11: 53,969,576	K141E	probably damaging	Het
Slc30a5	A	T	13: 100,806,694	I609K	probably damaging	Het
Slc44a4	T	C	17: 34,921,562	F244L	probably damaging	Het
Susd5	T	C	9: 114,082,504	Y161H	possibly damaging	Het
Syne3	A	G	12: 104,959,395		probably null	Het
Tbcd	G	C	11: 121,496,853		probably benign	Het
Tmc1	A	T	19: 20,900,851	N93K	probably benign	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Tmem131l	A	T	3: 83,928,732	V690D	probably damaging	Het
Trim8	A	G	19: 46,515,464	Q485R	possibly damaging	Het
Vmn2r63	A	T	7: 42,928,495	H206Q	probably benign	Het
Vmn2r77	T	A	7: 86,802,942	N443K	possibly damaging	Het
Zan	T	A	5: 137,389,316	I4878F	unknown	Het
Zfand4	A	G	6: 116,314,080	D344G	probably benign	Het

Other mutations in Nav1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01061:Nav1	APN	1	135450630	missense	probably damaging	1.00
IGL01455:Nav1	APN	1	135469635	missense	probably benign	0.44
IGL01650:Nav1	APN	1	135454760	missense	probably damaging	1.00
IGL01872:Nav1	APN	1	135454076	missense	probably damaging	1.00
IGL01967:Nav1	APN	1	135537245	missense	probably damaging	1.00
IGL02167:Nav1	APN	1	135470961	missense	probably damaging	1.00
IGL02278:Nav1	APN	1	135463714	splice site	probably benign
IGL02343:Nav1	APN	1	135454752	nonsense	probably null
IGL02378:Nav1	APN	1	135469978	missense	probably benign	0.02
IGL02554:Nav1	APN	1	135584913	synonymous	silent
IGL03148:Nav1	APN	1	135470024	missense	possibly damaging	0.94
IGL03286:Nav1	APN	1	135454536	missense	probably benign
IGL03372:Nav1	APN	1	135450903	missense	probably damaging	0.99
PIT4802001:Nav1	UTSW	1	135452933	missense	unknown
R0388:Nav1	UTSW	1	135448917	splice site	probably benign
R0390:Nav1	UTSW	1	135449966	missense	possibly damaging	0.80
R0395:Nav1	UTSW	1	135532621	nonsense	probably null
R0395:Nav1	UTSW	1	135532623	missense	probably damaging	0.97
R0416:Nav1	UTSW	1	135471126	missense	possibly damaging	0.73
R0463:Nav1	UTSW	1	135452207	missense	possibly damaging	0.76
R0538:Nav1	UTSW	1	135464692	splice site	probably benign
R0594:Nav1	UTSW	1	135467643	missense	possibly damaging	0.74
R0696:Nav1	UTSW	1	135532614	missense	probably damaging	0.99
R0699:Nav1	UTSW	1	135452949	missense	probably benign	0.00
R0759:Nav1	UTSW	1	135455260	missense	possibly damaging	0.73
R1164:Nav1	UTSW	1	135472410	missense	probably benign
R1169:Nav1	UTSW	1	135455205	missense	probably damaging	1.00
R1401:Nav1	UTSW	1	135460425	missense	probably benign	0.20
R1421:Nav1	UTSW	1	135585010	missense	probably damaging	1.00
R1642:Nav1	UTSW	1	135452272	missense	probably damaging	1.00
R1705:Nav1	UTSW	1	135584599	missense	probably damaging	1.00
R1713:Nav1	UTSW	1	135595234	intron	probably benign
R1728:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1729:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1730:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1739:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1740:Nav1	UTSW	1	135458389	critical splice donor site	probably null
R1762:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1783:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1784:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1785:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1895:Nav1	UTSW	1	135458658	missense	probably damaging	1.00
R1896:Nav1	UTSW	1	135460737	missense	probably benign	0.00
R1901:Nav1	UTSW	1	135472410	missense	probably benign	0.03
R1902:Nav1	UTSW	1	135472410	missense	probably benign	0.03
R1925:Nav1	UTSW	1	135607229	utr 5 prime	probably benign
R1939:Nav1	UTSW	1	135465898	missense	probably damaging	1.00
R1971:Nav1	UTSW	1	135532353	missense	probably benign	0.06
R2063:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2066:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2084:Nav1	UTSW	1	135607420	unclassified	probably benign
R2090:Nav1	UTSW	1	135607165	utr 5 prime	probably benign
R2107:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2110:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2111:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2112:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2136:Nav1	UTSW	1	135454436	missense	probably null	0.18
R2268:Nav1	UTSW	1	135472236	nonsense	probably null
R2269:Nav1	UTSW	1	135472236	nonsense	probably null
R2847:Nav1	UTSW	1	135450644	splice site	probably null
R2869:Nav1	UTSW	1	135460757	synonymous	silent
R2871:Nav1	UTSW	1	135460757	synonymous	silent
R2872:Nav1	UTSW	1	135460757	synonymous	silent
R2904:Nav1	UTSW	1	135585238	missense	probably benign
R3690:Nav1	UTSW	1	135467644	missense	probably benign	0.11
R3716:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3717:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3718:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3815:Nav1	UTSW	1	135471124	missense	possibly damaging	0.95
R4282:Nav1	UTSW	1	135457913	intron	probably benign
R4361:Nav1	UTSW	1	135607437	unclassified	probably benign
R4610:Nav1	UTSW	1	135592448	intron	probably benign
R4730:Nav1	UTSW	1	135607311	unclassified	probably benign
R4784:Nav1	UTSW	1	135458739	missense	probably damaging	1.00
R4788:Nav1	UTSW	1	135469723	missense	probably benign
R4808:Nav1	UTSW	1	135455204	missense	probably damaging	1.00
R4996:Nav1	UTSW	1	135465971	missense	probably damaging	1.00
R5284:Nav1	UTSW	1	135449963	nonsense	probably null
R5514:Nav1	UTSW	1	135470561	missense	probably benign	0.04
R5769:Nav1	UTSW	1	135452257	missense	probably damaging	1.00
R5834:Nav1	UTSW	1	135532406	missense	probably benign	0.07
R5898:Nav1	UTSW	1	135585146	missense	probably benign
R6081:Nav1	UTSW	1	135470822	missense	probably damaging	1.00
R6344:Nav1	UTSW	1	135450796	missense	probably damaging	1.00
R6378:Nav1	UTSW	1	135454695	missense	probably damaging	1.00
R7001:Nav1	UTSW	1	135454611	splice site	probably null
R7185:Nav1	UTSW	1	135471008	missense	possibly damaging	0.85
R7291:Nav1	UTSW	1	135465859	missense	probably damaging	1.00
R7361:Nav1	UTSW	1	135452853	missense	unknown
R7390:Nav1	UTSW	1	135584918	missense	probably benign	0.01
R7464:Nav1	UTSW	1	135584909	missense	probably benign	0.03
R7502:Nav1	UTSW	1	135469666	missense	probably damaging	1.00
R7601:Nav1	UTSW	1	135460438	missense	unknown
R7625:Nav1	UTSW	1	135467745	missense	probably damaging	1.00
R7639:Nav1	UTSW	1	135471122	missense	probably benign	0.09
R7786:Nav1	UTSW	1	135469995	missense	probably damaging	1.00
R7808:Nav1	UTSW	1	135452248	missense	unknown
R7815:Nav1	UTSW	1	135584639	missense	possibly damaging	0.49
R7825:Nav1	UTSW	1	135450044	missense	probably damaging	0.98
R8030:Nav1	UTSW	1	135537239	missense	probably damaging	1.00
R8370:Nav1	UTSW	1	135471144	nonsense	probably null
R8405:Nav1	UTSW	1	135454770	missense	unknown
R8720:Nav1	UTSW	1	135460726	missense	unknown
R8868:Nav1	UTSW	1	135585205	missense	probably benign	0.05
R9039:Nav1	UTSW	1	135443749	missense	unknown
R9261:Nav1	UTSW	1	135460357	missense	unknown
R9523:Nav1	UTSW	1	135452191	missense	unknown
Z1088:Nav1	UTSW	1	135470724	missense	probably benign	0.01
Z1176:Nav1	UTSW	1	135452886	missense	unknown
Z1176:Nav1	UTSW	1	135472420	missense	probably damaging	1.00
Z1177:Nav1	UTSW	1	135469731	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- AAGCAAACCTCTTCCTGCAG -3'
(R):5'- GTCCAAGTCTGAGCATTCGC -3'

Sequencing Primer
(F):5'- AGCAAGTCTTACCTAGCATCTGG -3'
(R):5'- TTCGCTCTTCCAACCCAAAGG -3'

Posted On

2021-10-11