Mutagenetix > Incidental Mutation

Incidental Mutation 'R8973:Esrrg'

683219

Institutional Source

Beutler Lab

Gene Symbol

Esrrg

Ensembl Gene

ENSMUSG00000026610

Gene Name

estrogen-related receptor gamma

Synonyms

ERR3, estrogen-related receptor 3, NR3B3, Errg

MMRRC Submission

068807-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

187608791-188214885 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 188198750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 346 (N346T)

Ref Sequence

ENSEMBL: ENSMUSP00000027906 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939]

AlphaFold

P62509

PDB Structure

crystal structure of the ligand-binding domain of the estrogen-related receptor gamma in complex with diethylstilbestrol [X-RAY DIFFRACTION]
crystal structure of the ligand-binding domain of the estrogen-related receptor gamma in complex with 4-hydroxytamoxifen [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027906
AA Change: N346T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: N346T

Domain	Start	End	E-Value	Type
low complexity region	57	70	N/A	INTRINSIC
ZnF_C4	125	196	4.04e-40	SMART
Blast:HOLI	203	233	5e-6	BLAST
HOLI	270	428	1.64e-40	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610
AA Change: N323T

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
ZnF_C4	102	173	4.04e-40	SMART
Blast:HOLI	180	210	4e-6	BLAST
HOLI	247	405	1.64e-40	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110939
AA Change: N323T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610
AA Change: N323T

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
ZnF_C4	102	173	4.04e-40	SMART
Blast:HOLI	180	210	4e-6	BLAST
HOLI	247	405	1.64e-40	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	T	G	18: 57,592,067	L123V	possibly damaging	Het
1810022K09Rik	C	T	3: 14,607,245	V97I	probably benign	Het
2410089E03Rik	T	C	15: 8,203,793	W1201R	probably damaging	Het
4930404N11Rik	T	C	10: 81,364,015	D129G	unknown	Het
Adamts16	A	T	13: 70,738,840	I975N	probably benign	Het
Adcy8	A	G	15: 64,699,135	*1250Q	probably null	Het
Anapc1	A	T	2: 128,664,032	I628N	probably damaging	Het
Ankrd39	C	T	1: 36,539,358		probably benign	Het
Ankub1	A	T	3: 57,665,511	S263R	possibly damaging	Het
Aoah	A	G	13: 20,840,155	I94V	probably benign	Het
Aox2	A	G	1: 58,289,954	D186G	probably benign	Het
Arap2	A	T	5: 62,698,325	C589*	probably null	Het
Armt1	T	C	10: 4,439,550	L69P	probably damaging	Het
Atxn7l3	T	A	11: 102,292,772	Y185F	probably benign	Het
BC067074	A	G	13: 113,319,759	T780A		Het
Cacna2d4	A	G	6: 119,241,181	D159G	probably damaging	Het
Camta2	C	A	11: 70,670,358	R1184L	probably benign	Het
Ccr7	G	A	11: 99,145,823	T91I	probably damaging	Het
Cdh9	A	G	15: 16,831,045	T323A	possibly damaging	Het
Cep250	C	T	2: 155,970,122	A446V	unknown	Het
Clec2e	C	A	6: 129,093,411	G216*	probably null	Het
Col25a1	T	C	3: 130,475,626	S176P	unknown	Het
Col4a3	A	C	1: 82,715,331	I1446L	probably benign	Het
Cse1l	A	G	2: 166,943,080	E823G	probably damaging	Het
Dchs2	A	G	3: 83,354,456	E2677G	possibly damaging	Het
Dis3l	T	C	9: 64,339,542	E77G	probably damaging	Het
Dnah6	T	C	6: 73,144,751	D1416G	probably benign	Het
Dpyd	T	C	3: 119,314,933		probably null	Het
Dst	A	G	1: 34,228,855	D3112G	probably damaging	Het
Dusp13	A	C	14: 21,734,906	N128K	probably benign	Het
Emilin2	T	G	17: 71,275,084	K216Q	probably benign	Het
Enam	T	C	5: 88,494,088	W254R	possibly damaging	Het
Fbn2	C	T	18: 58,153,856	G244R	probably damaging	Het
Fbxw25	A	G	9: 109,650,064	L373P		Het
Gm21060	C	A	19: 61,296,928	V48L	possibly damaging	Het
Gm30302	A	T	13: 49,788,239	D80E	probably benign	Het
Gtpbp3	T	C	8: 71,491,162	V254A	possibly damaging	Het
H2-DMb2	A	G	17: 34,148,725	D171G	probably damaging	Het
Hrg	A	T	16: 22,959,218	T242S	probably benign	Het
Inf2	G	T	12: 112,607,515	C751F	unknown	Het
Krt13	A	T	11: 100,119,438	M239K	possibly damaging	Het
Lrrc72	A	G	12: 36,253,294	S7P	probably benign	Het
Matn2	A	G	15: 34,433,050	I867V	probably benign	Het
Mdh2	C	T	5: 135,790,165	A325V	possibly damaging	Het
Mki67	C	A	7: 135,695,635	A2557S	possibly damaging	Het
Mrpl16	A	T	19: 11,772,943	R64*	probably null	Het
Nav1	T	C	1: 135,584,725	D199G	probably benign	Het
Nbn	T	C	4: 15,986,585	V662A	probably damaging	Het
Nek10	G	A	14: 14,931,321		probably null	Het
Olfr141	C	A	2: 86,806,856	V48F	probably benign	Het
Olfr298	A	G	7: 86,489,279	S91P	probably damaging	Het
Olfr834	C	A	9: 18,988,678	S230*	probably null	Het
Olfr884	T	A	9: 38,047,543	V107D	possibly damaging	Het
Pcsk7	T	G	9: 45,927,642	S617R	probably benign	Het
Pde10a	C	A	17: 8,924,239	Q6K	probably benign	Het
Pigq	A	C	17: 25,932,167	M396R	probably damaging	Het
Pkhd1l1	T	A	15: 44,586,437	D3865E	probably damaging	Het
Prag1	C	T	8: 36,099,590		probably benign	Het
Rint1	A	G	5: 23,811,730	T498A	probably benign	Het
Rnf213	T	A	11: 119,461,930	F3921I		Het
Rpp14	A	G	14: 8,088,768	S95G	probably benign	Het
Ryk	T	G	9: 102,861,921	Y78D	possibly damaging	Het
Sez6	A	T	11: 77,974,571	Q678L	probably damaging	Het
Slc22a21	T	C	11: 53,969,576	K141E	probably damaging	Het
Slc30a5	A	T	13: 100,806,694	I609K	probably damaging	Het
Slc44a4	T	C	17: 34,921,562	F244L	probably damaging	Het
Susd5	T	C	9: 114,082,504	Y161H	possibly damaging	Het
Syne3	A	G	12: 104,959,395		probably null	Het
Tbcd	G	C	11: 121,496,853		probably benign	Het
Tmc1	A	T	19: 20,900,851	N93K	probably benign	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Tmem131l	A	T	3: 83,928,732	V690D	probably damaging	Het
Trim8	A	G	19: 46,515,464	Q485R	possibly damaging	Het
Vmn2r63	A	T	7: 42,928,495	H206Q	probably benign	Het
Vmn2r77	T	A	7: 86,802,942	N443K	possibly damaging	Het
Zan	T	A	5: 137,389,316	I4878F	unknown	Het
Zfand4	A	G	6: 116,314,080	D344G	probably benign	Het

Other mutations in Esrrg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Esrrg	APN	1	188,210,910 (GRCm38)	missense	probably damaging	1.00
IGL01635:Esrrg	APN	1	188,198,600 (GRCm38)	missense	probably damaging	1.00
IGL01642:Esrrg	APN	1	188,210,915 (GRCm38)	missense	probably benign	0.01
IGL02740:Esrrg	APN	1	188,198,741 (GRCm38)	missense	probably benign	0.04
IGL03126:Esrrg	APN	1	187,997,987 (GRCm38)	intron	probably benign
IGL03391:Esrrg	APN	1	188,150,223 (GRCm38)	missense	possibly damaging	0.70
R0395:Esrrg	UTSW	1	188,198,635 (GRCm38)	missense	probably damaging	1.00
R0645:Esrrg	UTSW	1	188,043,341 (GRCm38)	missense	probably benign	0.00
R1593:Esrrg	UTSW	1	188,066,385 (GRCm38)	missense	possibly damaging	0.94
R1700:Esrrg	UTSW	1	188,043,653 (GRCm38)	missense	probably damaging	1.00
R1855:Esrrg	UTSW	1	188,211,098 (GRCm38)	missense	probably damaging	1.00
R3552:Esrrg	UTSW	1	188,150,190 (GRCm38)	missense	probably benign	0.05
R3605:Esrrg	UTSW	1	188,211,102 (GRCm38)	missense	possibly damaging	0.74
R4384:Esrrg	UTSW	1	188,043,711 (GRCm38)	missense	probably damaging	1.00
R5255:Esrrg	UTSW	1	188,146,358 (GRCm38)	missense	probably damaging	1.00
R5443:Esrrg	UTSW	1	188,043,425 (GRCm38)	missense	possibly damaging	0.78
R5511:Esrrg	UTSW	1	188,211,107 (GRCm38)	missense	probably damaging	1.00
R5516:Esrrg	UTSW	1	188,198,730 (GRCm38)	missense	possibly damaging	0.56
R5543:Esrrg	UTSW	1	188,150,254 (GRCm38)	missense	probably damaging	0.96
R5686:Esrrg	UTSW	1	188,150,198 (GRCm38)	missense	probably benign	0.24
R5990:Esrrg	UTSW	1	188,198,798 (GRCm38)	missense	probably damaging	1.00
R6030:Esrrg	UTSW	1	188,198,707 (GRCm38)	missense	probably benign	0.04
R6030:Esrrg	UTSW	1	188,198,707 (GRCm38)	missense	probably benign	0.04
R7058:Esrrg	UTSW	1	188,150,306 (GRCm38)	missense	probably damaging	1.00
R7487:Esrrg	UTSW	1	188,146,423 (GRCm38)	missense	probably benign	0.03
R8512:Esrrg	UTSW	1	188,043,580 (GRCm38)	nonsense	probably null
R8735:Esrrg	UTSW	1	188,201,008 (GRCm38)	intron	probably benign
R8986:Esrrg	UTSW	1	188,210,907 (GRCm38)	missense	possibly damaging	0.60
R9114:Esrrg	UTSW	1	188,146,409 (GRCm38)	missense	possibly damaging	0.75
R9114:Esrrg	UTSW	1	188,146,408 (GRCm38)	missense	probably benign	0.01
R9483:Esrrg	UTSW	1	188,198,651 (GRCm38)	missense	probably damaging	0.97
R9760:Esrrg	UTSW	1	188,043,372 (GRCm38)	missense	probably benign
Z1088:Esrrg	UTSW	1	188,150,218 (GRCm38)	missense	probably benign	0.04
Z1177:Esrrg	UTSW	1	188,043,555 (GRCm38)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCCTAGGAAGTGCAGGTTG -3'
(R):5'- TGGAGAACTTACAAACGAGGTC -3'

Sequencing Primer
(F):5'- GCAGGTTGCCTTATGAAATCCCAG -3'
(R):5'- TTACAAACGAGGTCTCACAAATC -3'

Posted On

2021-10-11