Incidental Mutation 'R8973:Cse1l'
ID 683223
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
MMRRC Submission 068807-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8973 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166785000 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 823 (E823G)
Ref Sequence ENSEMBL: ENSMUSP00000002790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000109235] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably damaging
Transcript: ENSMUST00000002790
AA Change: E823G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: E823G

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109235
SMART Domains Protein: ENSMUSP00000104858
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 3e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000163437
AA Change: E510G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: E510G

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168599
AA Change: E767G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: E767G

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 A T 13: 70,886,959 (GRCm39) I975N probably benign Het
Adcy8 A G 15: 64,570,984 (GRCm39) *1250Q probably null Het
Anapc1 A T 2: 128,505,952 (GRCm39) I628N probably damaging Het
Ankrd39 C T 1: 36,578,439 (GRCm39) probably benign Het
Ankub1 A T 3: 57,572,932 (GRCm39) S263R possibly damaging Het
Aoah A G 13: 21,024,325 (GRCm39) I94V probably benign Het
Aox1 A G 1: 58,329,113 (GRCm39) D186G probably benign Het
Arap2 A T 5: 62,855,668 (GRCm39) C589* probably null Het
Armt1 T C 10: 4,389,550 (GRCm39) L69P probably damaging Het
Atxn7l3 T A 11: 102,183,598 (GRCm39) Y185F probably benign Het
Cacna2d4 A G 6: 119,218,142 (GRCm39) D159G probably damaging Het
Camta2 C A 11: 70,561,184 (GRCm39) R1184L probably benign Het
Ccdc192 T G 18: 57,725,139 (GRCm39) L123V possibly damaging Het
Ccr7 G A 11: 99,036,649 (GRCm39) T91I probably damaging Het
Cdh9 A G 15: 16,831,131 (GRCm39) T323A possibly damaging Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Clec2e C A 6: 129,070,374 (GRCm39) G216* probably null Het
Col25a1 T C 3: 130,269,275 (GRCm39) S176P unknown Het
Col4a3 A C 1: 82,693,052 (GRCm39) I1446L probably benign Het
Cplane1 T C 15: 8,233,277 (GRCm39) W1201R probably damaging Het
Cspg4b A G 13: 113,456,293 (GRCm39) T780A Het
Dchs2 A G 3: 83,261,763 (GRCm39) E2677G possibly damaging Het
Dis3l T C 9: 64,246,824 (GRCm39) E77G probably damaging Het
Dnah6 T C 6: 73,121,734 (GRCm39) D1416G probably benign Het
Dpyd T C 3: 119,108,582 (GRCm39) probably null Het
Dst A G 1: 34,267,936 (GRCm39) D3112G probably damaging Het
Dusp13b A C 14: 21,784,974 (GRCm39) N128K probably benign Het
Emilin2 T G 17: 71,582,079 (GRCm39) K216Q probably benign Het
Enam T C 5: 88,641,947 (GRCm39) W254R possibly damaging Het
Esrrg A C 1: 187,930,947 (GRCm39) N346T possibly damaging Het
Fbn2 C T 18: 58,286,928 (GRCm39) G244R probably damaging Het
Fbxw25 A G 9: 109,479,132 (GRCm39) L373P Het
Gm21060 C A 19: 61,285,366 (GRCm39) V48L possibly damaging Het
Gtpbp3 T C 8: 71,943,806 (GRCm39) V254A possibly damaging Het
H2-DMb2 A G 17: 34,367,699 (GRCm39) D171G probably damaging Het
Hrg A T 16: 22,777,968 (GRCm39) T242S probably benign Het
Inf2 G T 12: 112,573,949 (GRCm39) C751F unknown Het
Krt13 A T 11: 100,010,264 (GRCm39) M239K possibly damaging Het
Lrrc72 A G 12: 36,303,293 (GRCm39) S7P probably benign Het
Matn2 A G 15: 34,433,196 (GRCm39) I867V probably benign Het
Mdh2 C T 5: 135,819,019 (GRCm39) A325V possibly damaging Het
Mki67 C A 7: 135,297,364 (GRCm39) A2557S possibly damaging Het
Mrpl16 A T 19: 11,750,307 (GRCm39) R64* probably null Het
Nav1 T C 1: 135,512,463 (GRCm39) D199G probably benign Het
Nbn T C 4: 15,986,585 (GRCm39) V662A probably damaging Het
Nek10 G A 14: 14,931,321 (GRCm38) probably null Het
Or14a257 A G 7: 86,138,487 (GRCm39) S91P probably damaging Het
Or5t18 C A 2: 86,637,200 (GRCm39) V48F probably benign Het
Or7g12 C A 9: 18,899,974 (GRCm39) S230* probably null Het
Or8b37 T A 9: 37,958,839 (GRCm39) V107D possibly damaging Het
Pcsk7 T G 9: 45,838,940 (GRCm39) S617R probably benign Het
Pde10a C A 17: 9,143,071 (GRCm39) Q6K probably benign Het
Pigq A C 17: 26,151,141 (GRCm39) M396R probably damaging Het
Pkhd1l1 T A 15: 44,449,833 (GRCm39) D3865E probably damaging Het
Prag1 C T 8: 36,566,744 (GRCm39) probably benign Het
Rbis C T 3: 14,672,305 (GRCm39) V97I probably benign Het
Rint1 A G 5: 24,016,728 (GRCm39) T498A probably benign Het
Rnf213 T A 11: 119,352,756 (GRCm39) F3921I Het
Rpp14 A G 14: 8,088,768 (GRCm38) S95G probably benign Het
Ryk T G 9: 102,739,120 (GRCm39) Y78D possibly damaging Het
Sez6 A T 11: 77,865,397 (GRCm39) Q678L probably damaging Het
Slc22a21 T C 11: 53,860,402 (GRCm39) K141E probably damaging Het
Slc30a5 A T 13: 100,943,202 (GRCm39) I609K probably damaging Het
Slc44a4 T C 17: 35,140,538 (GRCm39) F244L probably damaging Het
Spata31e1 A T 13: 49,941,715 (GRCm39) D80E probably benign Het
Susd5 T C 9: 113,911,572 (GRCm39) Y161H possibly damaging Het
Syne3 A G 12: 104,925,654 (GRCm39) probably null Het
Tbcd G C 11: 121,387,679 (GRCm39) probably benign Het
Tektip1 T C 10: 81,199,849 (GRCm39) D129G unknown Het
Tmc1 A T 19: 20,878,215 (GRCm39) N93K probably benign Het
Tmem100 T A 11: 89,926,302 (GRCm39) M43K probably benign Het
Tmem131l A T 3: 83,836,039 (GRCm39) V690D probably damaging Het
Trim8 A G 19: 46,503,903 (GRCm39) Q485R possibly damaging Het
Vmn2r63 A T 7: 42,577,919 (GRCm39) H206Q probably benign Het
Vmn2r77 T A 7: 86,452,150 (GRCm39) N443K possibly damaging Het
Zan T A 5: 137,387,578 (GRCm39) I4878F unknown Het
Zfand4 A G 6: 116,291,041 (GRCm39) D344G probably benign Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATAGCAGTCAGTCTGAGACAG -3'
(R):5'- AACTATCTTGCCTCCCCAGG -3'

Sequencing Primer
(F):5'- TATTCAGTACTGGGCTCC -3'
(R):5'- TAGCCAGTCAATTGTGCAGC -3'
Posted On 2021-10-11