Incidental Mutation 'R8973:Dpyd'
ID 683228
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8973 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 119314933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably null
Transcript: ENSMUST00000039177
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T G 18: 57,592,067 L123V possibly damaging Het
1810022K09Rik C T 3: 14,607,245 V97I probably benign Het
2410089E03Rik T C 15: 8,203,793 W1201R probably damaging Het
4930404N11Rik T C 10: 81,364,015 D129G unknown Het
Adamts16 A T 13: 70,738,840 I975N probably benign Het
Adcy8 A G 15: 64,699,135 *1250Q probably null Het
Anapc1 A T 2: 128,664,032 I628N probably damaging Het
Ankub1 A T 3: 57,665,511 S263R possibly damaging Het
Aoah A G 13: 20,840,155 I94V probably benign Het
Aox2 A G 1: 58,289,954 D186G probably benign Het
Arap2 A T 5: 62,698,325 C589* probably null Het
Armt1 T C 10: 4,439,550 L69P probably damaging Het
Atxn7l3 T A 11: 102,292,772 Y185F probably benign Het
BC067074 A G 13: 113,319,759 T780A Het
Cacna2d4 A G 6: 119,241,181 D159G probably damaging Het
Camta2 C A 11: 70,670,358 R1184L probably benign Het
Ccr7 G A 11: 99,145,823 T91I probably damaging Het
Cdh9 A G 15: 16,831,045 T323A possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Clec2e C A 6: 129,093,411 G216* probably null Het
Col25a1 T C 3: 130,475,626 S176P unknown Het
Col4a3 A C 1: 82,715,331 I1446L probably benign Het
Cse1l A G 2: 166,943,080 E823G probably damaging Het
Dchs2 A G 3: 83,354,456 E2677G possibly damaging Het
Dis3l T C 9: 64,339,542 E77G probably damaging Het
Dnah6 T C 6: 73,144,751 D1416G probably benign Het
Dst A G 1: 34,228,855 D3112G probably damaging Het
Dusp13 A C 14: 21,734,906 N128K probably benign Het
Emilin2 T G 17: 71,275,084 K216Q probably benign Het
Enam T C 5: 88,494,088 W254R possibly damaging Het
Esrrg A C 1: 188,198,750 N346T possibly damaging Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fbxw25 A G 9: 109,650,064 L373P Het
Gm21060 C A 19: 61,296,928 V48L possibly damaging Het
Gm30302 A T 13: 49,788,239 D80E probably benign Het
Gtpbp3 T C 8: 71,491,162 V254A possibly damaging Het
H2-DMb2 A G 17: 34,148,725 D171G probably damaging Het
Hrg A T 16: 22,959,218 T242S probably benign Het
Inf2 G T 12: 112,607,515 C751F unknown Het
Krt13 A T 11: 100,119,438 M239K possibly damaging Het
Lrrc72 A G 12: 36,253,294 S7P probably benign Het
Matn2 A G 15: 34,433,050 I867V probably benign Het
Mdh2 C T 5: 135,790,165 A325V possibly damaging Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mrpl16 A T 19: 11,772,943 R64* probably null Het
Nav1 T C 1: 135,584,725 D199G probably benign Het
Nbn T C 4: 15,986,585 V662A probably damaging Het
Nek10 G A 14: 14,931,321 probably null Het
Olfr141 C A 2: 86,806,856 V48F probably benign Het
Olfr298 A G 7: 86,489,279 S91P probably damaging Het
Olfr834 C A 9: 18,988,678 S230* probably null Het
Olfr884 T A 9: 38,047,543 V107D possibly damaging Het
Pcsk7 T G 9: 45,927,642 S617R probably benign Het
Pde10a C A 17: 8,924,239 Q6K probably benign Het
Pigq A C 17: 25,932,167 M396R probably damaging Het
Pkhd1l1 T A 15: 44,586,437 D3865E probably damaging Het
Prag1 C T 8: 36,099,590 probably benign Het
Rint1 A G 5: 23,811,730 T498A probably benign Het
Rnf213 T A 11: 119,461,930 F3921I Het
Rpp14 A G 14: 8,088,768 S95G probably benign Het
Ryk T G 9: 102,861,921 Y78D possibly damaging Het
Sez6 A T 11: 77,974,571 Q678L probably damaging Het
Slc22a21 T C 11: 53,969,576 K141E probably damaging Het
Slc30a5 A T 13: 100,806,694 I609K probably damaging Het
Slc44a4 T C 17: 34,921,562 F244L probably damaging Het
Susd5 T C 9: 114,082,504 Y161H possibly damaging Het
Syne3 A G 12: 104,959,395 probably null Het
Tmc1 A T 19: 20,900,851 N93K probably benign Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Tmem131l A T 3: 83,928,732 V690D probably damaging Het
Trim8 A G 19: 46,515,464 Q485R possibly damaging Het
Vmn2r63 A T 7: 42,928,495 H206Q probably benign Het
Vmn2r77 T A 7: 86,802,942 N443K possibly damaging Het
Zan T A 5: 137,389,316 I4878F unknown Het
Zfand4 A G 6: 116,314,080 D344G probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCGCTATTCAGAATCAG -3'
(R):5'- GGCACTTCACATTGCCAACTTC -3'

Sequencing Primer
(F):5'- GCGCTATTCAGAATCAGGACTTC -3'
(R):5'- GTTTTATCAGACAGTAACTGGGAGAC -3'
Posted On 2021-10-11