Incidental Mutation 'R8973:Dpyd'
ID 683228
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms E330028L06Rik, DPD
MMRRC Submission 068807-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8973 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 118355778-119226573 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 119108582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably null
Transcript: ENSMUST00000039177
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 A T 13: 70,886,959 (GRCm39) I975N probably benign Het
Adcy8 A G 15: 64,570,984 (GRCm39) *1250Q probably null Het
Anapc1 A T 2: 128,505,952 (GRCm39) I628N probably damaging Het
Ankrd39 C T 1: 36,578,439 (GRCm39) probably benign Het
Ankub1 A T 3: 57,572,932 (GRCm39) S263R possibly damaging Het
Aoah A G 13: 21,024,325 (GRCm39) I94V probably benign Het
Aox1 A G 1: 58,329,113 (GRCm39) D186G probably benign Het
Arap2 A T 5: 62,855,668 (GRCm39) C589* probably null Het
Armt1 T C 10: 4,389,550 (GRCm39) L69P probably damaging Het
Atxn7l3 T A 11: 102,183,598 (GRCm39) Y185F probably benign Het
Cacna2d4 A G 6: 119,218,142 (GRCm39) D159G probably damaging Het
Camta2 C A 11: 70,561,184 (GRCm39) R1184L probably benign Het
Ccdc192 T G 18: 57,725,139 (GRCm39) L123V possibly damaging Het
Ccr7 G A 11: 99,036,649 (GRCm39) T91I probably damaging Het
Cdh9 A G 15: 16,831,131 (GRCm39) T323A possibly damaging Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Clec2e C A 6: 129,070,374 (GRCm39) G216* probably null Het
Col25a1 T C 3: 130,269,275 (GRCm39) S176P unknown Het
Col4a3 A C 1: 82,693,052 (GRCm39) I1446L probably benign Het
Cplane1 T C 15: 8,233,277 (GRCm39) W1201R probably damaging Het
Cse1l A G 2: 166,785,000 (GRCm39) E823G probably damaging Het
Cspg4b A G 13: 113,456,293 (GRCm39) T780A Het
Dchs2 A G 3: 83,261,763 (GRCm39) E2677G possibly damaging Het
Dis3l T C 9: 64,246,824 (GRCm39) E77G probably damaging Het
Dnah6 T C 6: 73,121,734 (GRCm39) D1416G probably benign Het
Dst A G 1: 34,267,936 (GRCm39) D3112G probably damaging Het
Dusp13b A C 14: 21,784,974 (GRCm39) N128K probably benign Het
Emilin2 T G 17: 71,582,079 (GRCm39) K216Q probably benign Het
Enam T C 5: 88,641,947 (GRCm39) W254R possibly damaging Het
Esrrg A C 1: 187,930,947 (GRCm39) N346T possibly damaging Het
Fbn2 C T 18: 58,286,928 (GRCm39) G244R probably damaging Het
Fbxw25 A G 9: 109,479,132 (GRCm39) L373P Het
Gm21060 C A 19: 61,285,366 (GRCm39) V48L possibly damaging Het
Gtpbp3 T C 8: 71,943,806 (GRCm39) V254A possibly damaging Het
H2-DMb2 A G 17: 34,367,699 (GRCm39) D171G probably damaging Het
Hrg A T 16: 22,777,968 (GRCm39) T242S probably benign Het
Inf2 G T 12: 112,573,949 (GRCm39) C751F unknown Het
Krt13 A T 11: 100,010,264 (GRCm39) M239K possibly damaging Het
Lrrc72 A G 12: 36,303,293 (GRCm39) S7P probably benign Het
Matn2 A G 15: 34,433,196 (GRCm39) I867V probably benign Het
Mdh2 C T 5: 135,819,019 (GRCm39) A325V possibly damaging Het
Mki67 C A 7: 135,297,364 (GRCm39) A2557S possibly damaging Het
Mrpl16 A T 19: 11,750,307 (GRCm39) R64* probably null Het
Nav1 T C 1: 135,512,463 (GRCm39) D199G probably benign Het
Nbn T C 4: 15,986,585 (GRCm39) V662A probably damaging Het
Nek10 G A 14: 14,931,321 (GRCm38) probably null Het
Or14a257 A G 7: 86,138,487 (GRCm39) S91P probably damaging Het
Or5t18 C A 2: 86,637,200 (GRCm39) V48F probably benign Het
Or7g12 C A 9: 18,899,974 (GRCm39) S230* probably null Het
Or8b37 T A 9: 37,958,839 (GRCm39) V107D possibly damaging Het
Pcsk7 T G 9: 45,838,940 (GRCm39) S617R probably benign Het
Pde10a C A 17: 9,143,071 (GRCm39) Q6K probably benign Het
Pigq A C 17: 26,151,141 (GRCm39) M396R probably damaging Het
Pkhd1l1 T A 15: 44,449,833 (GRCm39) D3865E probably damaging Het
Prag1 C T 8: 36,566,744 (GRCm39) probably benign Het
Rbis C T 3: 14,672,305 (GRCm39) V97I probably benign Het
Rint1 A G 5: 24,016,728 (GRCm39) T498A probably benign Het
Rnf213 T A 11: 119,352,756 (GRCm39) F3921I Het
Rpp14 A G 14: 8,088,768 (GRCm38) S95G probably benign Het
Ryk T G 9: 102,739,120 (GRCm39) Y78D possibly damaging Het
Sez6 A T 11: 77,865,397 (GRCm39) Q678L probably damaging Het
Slc22a21 T C 11: 53,860,402 (GRCm39) K141E probably damaging Het
Slc30a5 A T 13: 100,943,202 (GRCm39) I609K probably damaging Het
Slc44a4 T C 17: 35,140,538 (GRCm39) F244L probably damaging Het
Spata31e1 A T 13: 49,941,715 (GRCm39) D80E probably benign Het
Susd5 T C 9: 113,911,572 (GRCm39) Y161H possibly damaging Het
Syne3 A G 12: 104,925,654 (GRCm39) probably null Het
Tbcd G C 11: 121,387,679 (GRCm39) probably benign Het
Tektip1 T C 10: 81,199,849 (GRCm39) D129G unknown Het
Tmc1 A T 19: 20,878,215 (GRCm39) N93K probably benign Het
Tmem100 T A 11: 89,926,302 (GRCm39) M43K probably benign Het
Tmem131l A T 3: 83,836,039 (GRCm39) V690D probably damaging Het
Trim8 A G 19: 46,503,903 (GRCm39) Q485R possibly damaging Het
Vmn2r63 A T 7: 42,577,919 (GRCm39) H206Q probably benign Het
Vmn2r77 T A 7: 86,452,150 (GRCm39) N443K possibly damaging Het
Zan T A 5: 137,387,578 (GRCm39) I4878F unknown Het
Zfand4 A G 6: 116,291,041 (GRCm39) D344G probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118,737,891 (GRCm39) missense probably damaging 1.00
IGL00508:Dpyd APN 3 118,858,636 (GRCm39) missense probably benign 0.06
IGL02113:Dpyd APN 3 118,792,868 (GRCm39) missense probably benign 0.06
IGL02177:Dpyd APN 3 118,858,559 (GRCm39) missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118,710,891 (GRCm39) missense probably benign 0.07
IGL03106:Dpyd APN 3 118,988,783 (GRCm39) missense probably benign 0.03
IGL03399:Dpyd APN 3 119,108,426 (GRCm39) missense probably damaging 0.98
F5770:Dpyd UTSW 3 118,690,775 (GRCm39) nonsense probably null
F6893:Dpyd UTSW 3 118,597,783 (GRCm39) critical splice donor site probably null
R0014:Dpyd UTSW 3 118,935,584 (GRCm39) missense probably damaging 1.00
R0081:Dpyd UTSW 3 118,737,904 (GRCm39) missense probably benign 0.00
R0267:Dpyd UTSW 3 118,710,921 (GRCm39) missense probably benign
R0349:Dpyd UTSW 3 118,710,748 (GRCm39) nonsense probably null
R0387:Dpyd UTSW 3 119,220,875 (GRCm39) missense probably benign 0.21
R0523:Dpyd UTSW 3 118,692,852 (GRCm39) missense probably benign
R0555:Dpyd UTSW 3 119,225,191 (GRCm39) missense probably damaging 1.00
R0652:Dpyd UTSW 3 119,220,924 (GRCm39) missense probably damaging 1.00
R0741:Dpyd UTSW 3 118,468,154 (GRCm39) missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118,692,810 (GRCm39) splice site probably benign
R1554:Dpyd UTSW 3 118,858,695 (GRCm39) splice site probably null
R1610:Dpyd UTSW 3 118,858,655 (GRCm39) missense probably benign
R1710:Dpyd UTSW 3 118,404,092 (GRCm39) critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118,710,780 (GRCm39) missense probably damaging 1.00
R2103:Dpyd UTSW 3 118,858,601 (GRCm39) missense probably benign 0.02
R2130:Dpyd UTSW 3 118,468,217 (GRCm39) missense probably benign
R2131:Dpyd UTSW 3 118,468,217 (GRCm39) missense probably benign
R2882:Dpyd UTSW 3 118,858,679 (GRCm39) missense probably damaging 0.99
R3771:Dpyd UTSW 3 119,205,927 (GRCm39) critical splice donor site probably null
R3978:Dpyd UTSW 3 118,690,738 (GRCm39) critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118,690,737 (GRCm39) critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118,690,815 (GRCm39) missense probably benign 0.03
R4065:Dpyd UTSW 3 118,690,738 (GRCm39) critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118,690,738 (GRCm39) critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119,225,233 (GRCm39) missense probably damaging 1.00
R4502:Dpyd UTSW 3 118,591,186 (GRCm39) missense probably damaging 1.00
R4638:Dpyd UTSW 3 119,059,726 (GRCm39) missense probably benign 0.03
R4980:Dpyd UTSW 3 118,710,767 (GRCm39) missense probably damaging 0.99
R5262:Dpyd UTSW 3 118,591,071 (GRCm39) nonsense probably null
R5348:Dpyd UTSW 3 118,575,592 (GRCm39) missense probably benign
R5587:Dpyd UTSW 3 118,858,600 (GRCm39) missense probably damaging 1.00
R5611:Dpyd UTSW 3 118,987,942 (GRCm39) missense probably benign
R5665:Dpyd UTSW 3 118,710,741 (GRCm39) missense probably damaging 1.00
R5716:Dpyd UTSW 3 118,692,828 (GRCm39) missense probably damaging 1.00
R5786:Dpyd UTSW 3 119,220,886 (GRCm39) missense probably damaging 0.97
R6046:Dpyd UTSW 3 119,225,224 (GRCm39) missense probably benign 0.01
R6404:Dpyd UTSW 3 119,059,606 (GRCm39) missense probably benign 0.02
R6703:Dpyd UTSW 3 118,690,849 (GRCm39) splice site probably null
R7037:Dpyd UTSW 3 118,692,938 (GRCm39) missense probably benign 0.00
R7215:Dpyd UTSW 3 119,059,681 (GRCm39) missense probably benign 0.11
R7301:Dpyd UTSW 3 118,692,933 (GRCm39) missense possibly damaging 0.90
R7336:Dpyd UTSW 3 118,858,570 (GRCm39) missense probably damaging 1.00
R7714:Dpyd UTSW 3 118,597,780 (GRCm39) missense probably benign 0.01
R8238:Dpyd UTSW 3 118,988,842 (GRCm39) splice site probably null
R8306:Dpyd UTSW 3 119,205,822 (GRCm39) missense probably benign
R8315:Dpyd UTSW 3 119,108,534 (GRCm39) missense probably benign 0.09
R8321:Dpyd UTSW 3 118,575,573 (GRCm39) missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119,108,452 (GRCm39) missense possibly damaging 0.60
R8735:Dpyd UTSW 3 118,935,565 (GRCm39) missense possibly damaging 0.74
R8750:Dpyd UTSW 3 118,935,585 (GRCm39) missense probably damaging 1.00
R8874:Dpyd UTSW 3 118,792,981 (GRCm39) missense probably damaging 1.00
R8910:Dpyd UTSW 3 118,404,167 (GRCm39) missense probably benign 0.17
R9070:Dpyd UTSW 3 118,792,892 (GRCm39) missense probably damaging 0.98
R9132:Dpyd UTSW 3 118,710,897 (GRCm39) missense probably damaging 1.00
R9198:Dpyd UTSW 3 118,553,303 (GRCm39) critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119,108,447 (GRCm39) missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119,108,560 (GRCm39) missense probably benign
V7581:Dpyd UTSW 3 118,690,775 (GRCm39) nonsense probably null
V7582:Dpyd UTSW 3 118,690,775 (GRCm39) nonsense probably null
V7583:Dpyd UTSW 3 118,690,775 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCGCTATTCAGAATCAG -3'
(R):5'- GGCACTTCACATTGCCAACTTC -3'

Sequencing Primer
(F):5'- GCGCTATTCAGAATCAGGACTTC -3'
(R):5'- GTTTTATCAGACAGTAACTGGGAGAC -3'
Posted On 2021-10-11