Incidental Mutation 'R8973:Rint1'
ID 683231
Institutional Source Beutler Lab
Gene Symbol Rint1
Ensembl Gene ENSMUSG00000028999
Gene Name RAD50 interactor 1
Synonyms 2810450M21Rik, 1500019C06Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8973 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 23787711-23820369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23811730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 498 (T498A)
Ref Sequence ENSEMBL: ENSMUSP00000030852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]
AlphaFold Q8BZ36
Predicted Effect probably benign
Transcript: ENSMUST00000030852
AA Change: T498A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: T498A

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 304 784 2.3e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115113
AA Change: T440A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: T440A

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 246 727 1.2e-161 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T G 18: 57,592,067 L123V possibly damaging Het
1810022K09Rik C T 3: 14,607,245 V97I probably benign Het
2410089E03Rik T C 15: 8,203,793 W1201R probably damaging Het
4930404N11Rik T C 10: 81,364,015 D129G unknown Het
Adamts16 A T 13: 70,738,840 I975N probably benign Het
Adcy8 A G 15: 64,699,135 *1250Q probably null Het
Anapc1 A T 2: 128,664,032 I628N probably damaging Het
Ankrd39 C T 1: 36,539,358 probably benign Het
Ankub1 A T 3: 57,665,511 S263R possibly damaging Het
Aoah A G 13: 20,840,155 I94V probably benign Het
Aox2 A G 1: 58,289,954 D186G probably benign Het
Arap2 A T 5: 62,698,325 C589* probably null Het
Armt1 T C 10: 4,439,550 L69P probably damaging Het
Atxn7l3 T A 11: 102,292,772 Y185F probably benign Het
BC067074 A G 13: 113,319,759 T780A Het
Cacna2d4 A G 6: 119,241,181 D159G probably damaging Het
Camta2 C A 11: 70,670,358 R1184L probably benign Het
Ccr7 G A 11: 99,145,823 T91I probably damaging Het
Cdh9 A G 15: 16,831,045 T323A possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Clec2e C A 6: 129,093,411 G216* probably null Het
Col25a1 T C 3: 130,475,626 S176P unknown Het
Col4a3 A C 1: 82,715,331 I1446L probably benign Het
Cse1l A G 2: 166,943,080 E823G probably damaging Het
Dchs2 A G 3: 83,354,456 E2677G possibly damaging Het
Dis3l T C 9: 64,339,542 E77G probably damaging Het
Dnah6 T C 6: 73,144,751 D1416G probably benign Het
Dpyd T C 3: 119,314,933 probably null Het
Dst A G 1: 34,228,855 D3112G probably damaging Het
Dusp13 A C 14: 21,734,906 N128K probably benign Het
Emilin2 T G 17: 71,275,084 K216Q probably benign Het
Enam T C 5: 88,494,088 W254R possibly damaging Het
Esrrg A C 1: 188,198,750 N346T possibly damaging Het
Fbn2 C T 18: 58,153,856 G244R probably damaging Het
Fbxw25 A G 9: 109,650,064 L373P Het
Gm21060 C A 19: 61,296,928 V48L possibly damaging Het
Gm30302 A T 13: 49,788,239 D80E probably benign Het
Gtpbp3 T C 8: 71,491,162 V254A possibly damaging Het
H2-DMb2 A G 17: 34,148,725 D171G probably damaging Het
Hrg A T 16: 22,959,218 T242S probably benign Het
Inf2 G T 12: 112,607,515 C751F unknown Het
Krt13 A T 11: 100,119,438 M239K possibly damaging Het
Lrrc72 A G 12: 36,253,294 S7P probably benign Het
Matn2 A G 15: 34,433,050 I867V probably benign Het
Mdh2 C T 5: 135,790,165 A325V possibly damaging Het
Mki67 C A 7: 135,695,635 A2557S possibly damaging Het
Mrpl16 A T 19: 11,772,943 R64* probably null Het
Nav1 T C 1: 135,584,725 D199G probably benign Het
Nbn T C 4: 15,986,585 V662A probably damaging Het
Nek10 G A 14: 14,931,321 probably null Het
Olfr141 C A 2: 86,806,856 V48F probably benign Het
Olfr298 A G 7: 86,489,279 S91P probably damaging Het
Olfr834 C A 9: 18,988,678 S230* probably null Het
Olfr884 T A 9: 38,047,543 V107D possibly damaging Het
Pcsk7 T G 9: 45,927,642 S617R probably benign Het
Pde10a C A 17: 8,924,239 Q6K probably benign Het
Pigq A C 17: 25,932,167 M396R probably damaging Het
Pkhd1l1 T A 15: 44,586,437 D3865E probably damaging Het
Prag1 C T 8: 36,099,590 probably benign Het
Rnf213 T A 11: 119,461,930 F3921I Het
Rpp14 A G 14: 8,088,768 S95G probably benign Het
Ryk T G 9: 102,861,921 Y78D possibly damaging Het
Sez6 A T 11: 77,974,571 Q678L probably damaging Het
Slc22a21 T C 11: 53,969,576 K141E probably damaging Het
Slc30a5 A T 13: 100,806,694 I609K probably damaging Het
Slc44a4 T C 17: 34,921,562 F244L probably damaging Het
Susd5 T C 9: 114,082,504 Y161H possibly damaging Het
Syne3 A G 12: 104,959,395 probably null Het
Tbcd G C 11: 121,496,853 probably benign Het
Tmc1 A T 19: 20,900,851 N93K probably benign Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Tmem131l A T 3: 83,928,732 V690D probably damaging Het
Trim8 A G 19: 46,515,464 Q485R possibly damaging Het
Vmn2r63 A T 7: 42,928,495 H206Q probably benign Het
Vmn2r77 T A 7: 86,802,942 N443K possibly damaging Het
Zan T A 5: 137,389,316 I4878F unknown Het
Zfand4 A G 6: 116,314,080 D344G probably benign Het
Other mutations in Rint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rint1 APN 5 23794431 missense probably benign 0.00
IGL00596:Rint1 APN 5 23811865 missense probably damaging 0.99
IGL01685:Rint1 APN 5 23787834 unclassified probably benign
IGL02428:Rint1 APN 5 23794452 nonsense probably null
IGL03007:Rint1 APN 5 23815701 missense probably benign 0.00
IGL03280:Rint1 APN 5 23817078 missense probably damaging 1.00
breakage UTSW 5 23800722 missense probably damaging 0.99
IGL02799:Rint1 UTSW 5 23819480 missense possibly damaging 0.93
R0062:Rint1 UTSW 5 23787828 unclassified probably benign
R0243:Rint1 UTSW 5 23816932 splice site probably benign
R1102:Rint1 UTSW 5 23805567 splice site probably benign
R1552:Rint1 UTSW 5 23800658 missense probably benign 0.00
R1729:Rint1 UTSW 5 23809843 missense probably benign 0.00
R1784:Rint1 UTSW 5 23809843 missense probably benign 0.00
R2070:Rint1 UTSW 5 23810929 missense possibly damaging 0.94
R2920:Rint1 UTSW 5 23805402 missense probably benign 0.00
R3114:Rint1 UTSW 5 23819420 missense probably benign 0.27
R4398:Rint1 UTSW 5 23794447 missense possibly damaging 0.55
R4756:Rint1 UTSW 5 23809793 missense probably damaging 1.00
R5246:Rint1 UTSW 5 23800811 missense probably damaging 0.99
R5452:Rint1 UTSW 5 23794365 missense probably benign 0.01
R5566:Rint1 UTSW 5 23810953 missense probably damaging 1.00
R5709:Rint1 UTSW 5 23815833 missense probably damaging 0.98
R6524:Rint1 UTSW 5 23815739 missense probably benign 0.00
R7346:Rint1 UTSW 5 23815653 missense possibly damaging 0.82
R7549:Rint1 UTSW 5 23815704 missense probably benign
R7634:Rint1 UTSW 5 23805479 missense probably benign 0.00
R7647:Rint1 UTSW 5 23800802 missense probably damaging 1.00
R7885:Rint1 UTSW 5 23805644 missense probably benign
R7895:Rint1 UTSW 5 23800722 missense probably damaging 0.99
R8347:Rint1 UTSW 5 23811772 missense probably damaging 1.00
R8791:Rint1 UTSW 5 23800596 missense probably damaging 0.99
R8900:Rint1 UTSW 5 23811884 missense possibly damaging 0.77
R8916:Rint1 UTSW 5 23787828 unclassified probably benign
R9245:Rint1 UTSW 5 23805413 missense probably benign
R9339:Rint1 UTSW 5 23788357 makesense probably null
R9630:Rint1 UTSW 5 23815812 missense possibly damaging 0.82
R9718:Rint1 UTSW 5 23800723 missense possibly damaging 0.53
Z1088:Rint1 UTSW 5 23805314 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTAGAAATCTGTGGCAGTAGC -3'
(R):5'- ACATTGTCAGCCCAGTCTG -3'

Sequencing Primer
(F):5'- GTAGCCTCACTTTTGATTGAGCCAG -3'
(R):5'- CAGTCTGCCAGCACTGC -3'
Posted On 2021-10-11