Mutagenetix > Incidental Mutation

Incidental Mutation 'R8973:Sez6'

683257

Institutional Source

Beutler Lab

Gene Symbol

Sez6

Ensembl Gene

ENSMUSG00000000632

Gene Name

seizure related gene 6

Synonyms

D11Bhm177e, sez-6

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77930800-77979048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77974571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 678 (Q678L)

Ref Sequence

ENSEMBL: ENSMUSP00000091532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]

AlphaFold

Q7TSK2

Predicted Effect

probably damaging
Transcript: ENSMUST00000000646
AA Change: Q678L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: Q678L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	910	932	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000093995
AA Change: Q678L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: Q678L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140630

SMART Domains

Protein: ENSMUSP00000115660
Gene: ENSMUSG00000000632

Domain	Start	End	E-Value	Type
CUB	29	140	9.8e-28	SMART
CCP	157	214	5.43e-12	SMART
Pfam:CUB	218	278	1.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151982

SMART Domains

Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

Domain	Start	End	E-Value	Type
low complexity region	57	69	N/A	INTRINSIC
CUB	75	184	9.36e-2	SMART
CCP	188	243	1.23e-10	SMART
CUB	247	358	8.08e-29	SMART
low complexity region	379	394	N/A	INTRINSIC

Meta Mutation Damage Score

0.7842

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	T	G	18: 57,592,067	L123V	possibly damaging	Het
1810022K09Rik	C	T	3: 14,607,245	V97I	probably benign	Het
2410089E03Rik	T	C	15: 8,203,793	W1201R	probably damaging	Het
4930404N11Rik	T	C	10: 81,364,015	D129G	unknown	Het
Adamts16	A	T	13: 70,738,840	I975N	probably benign	Het
Adcy8	A	G	15: 64,699,135	*1250Q	probably null	Het
Anapc1	A	T	2: 128,664,032	I628N	probably damaging	Het
Ankrd39	C	T	1: 36,539,358		probably benign	Het
Ankub1	A	T	3: 57,665,511	S263R	possibly damaging	Het
Aoah	A	G	13: 20,840,155	I94V	probably benign	Het
Aox2	A	G	1: 58,289,954	D186G	probably benign	Het
Arap2	A	T	5: 62,698,325	C589*	probably null	Het
Armt1	T	C	10: 4,439,550	L69P	probably damaging	Het
Atxn7l3	T	A	11: 102,292,772	Y185F	probably benign	Het
BC067074	A	G	13: 113,319,759	T780A		Het
Cacna2d4	A	G	6: 119,241,181	D159G	probably damaging	Het
Camta2	C	A	11: 70,670,358	R1184L	probably benign	Het
Ccr7	G	A	11: 99,145,823	T91I	probably damaging	Het
Cdh9	A	G	15: 16,831,045	T323A	possibly damaging	Het
Cep250	C	T	2: 155,970,122	A446V	unknown	Het
Clec2e	C	A	6: 129,093,411	G216*	probably null	Het
Col25a1	T	C	3: 130,475,626	S176P	unknown	Het
Col4a3	A	C	1: 82,715,331	I1446L	probably benign	Het
Cse1l	A	G	2: 166,943,080	E823G	probably damaging	Het
Dchs2	A	G	3: 83,354,456	E2677G	possibly damaging	Het
Dis3l	T	C	9: 64,339,542	E77G	probably damaging	Het
Dnah6	T	C	6: 73,144,751	D1416G	probably benign	Het
Dpyd	T	C	3: 119,314,933		probably null	Het
Dst	A	G	1: 34,228,855	D3112G	probably damaging	Het
Dusp13	A	C	14: 21,734,906	N128K	probably benign	Het
Emilin2	T	G	17: 71,275,084	K216Q	probably benign	Het
Enam	T	C	5: 88,494,088	W254R	possibly damaging	Het
Esrrg	A	C	1: 188,198,750	N346T	possibly damaging	Het
Fbn2	C	T	18: 58,153,856	G244R	probably damaging	Het
Fbxw25	A	G	9: 109,650,064	L373P		Het
Gm21060	C	A	19: 61,296,928	V48L	possibly damaging	Het
Gm30302	A	T	13: 49,788,239	D80E	probably benign	Het
Gtpbp3	T	C	8: 71,491,162	V254A	possibly damaging	Het
H2-DMb2	A	G	17: 34,148,725	D171G	probably damaging	Het
Hrg	A	T	16: 22,959,218	T242S	probably benign	Het
Inf2	G	T	12: 112,607,515	C751F	unknown	Het
Krt13	A	T	11: 100,119,438	M239K	possibly damaging	Het
Lrrc72	A	G	12: 36,253,294	S7P	probably benign	Het
Matn2	A	G	15: 34,433,050	I867V	probably benign	Het
Mdh2	C	T	5: 135,790,165	A325V	possibly damaging	Het
Mki67	C	A	7: 135,695,635	A2557S	possibly damaging	Het
Mrpl16	A	T	19: 11,772,943	R64*	probably null	Het
Nav1	T	C	1: 135,584,725	D199G	probably benign	Het
Nbn	T	C	4: 15,986,585	V662A	probably damaging	Het
Nek10	G	A	14: 14,931,321		probably null	Het
Olfr141	C	A	2: 86,806,856	V48F	probably benign	Het
Olfr298	A	G	7: 86,489,279	S91P	probably damaging	Het
Olfr834	C	A	9: 18,988,678	S230*	probably null	Het
Olfr884	T	A	9: 38,047,543	V107D	possibly damaging	Het
Pcsk7	T	G	9: 45,927,642	S617R	probably benign	Het
Pde10a	C	A	17: 8,924,239	Q6K	probably benign	Het
Pigq	A	C	17: 25,932,167	M396R	probably damaging	Het
Pkhd1l1	T	A	15: 44,586,437	D3865E	probably damaging	Het
Prag1	C	T	8: 36,099,590		probably benign	Het
Rint1	A	G	5: 23,811,730	T498A	probably benign	Het
Rnf213	T	A	11: 119,461,930	F3921I		Het
Rpp14	A	G	14: 8,088,768	S95G	probably benign	Het
Ryk	T	G	9: 102,861,921	Y78D	possibly damaging	Het
Slc22a21	T	C	11: 53,969,576	K141E	probably damaging	Het
Slc30a5	A	T	13: 100,806,694	I609K	probably damaging	Het
Slc44a4	T	C	17: 34,921,562	F244L	probably damaging	Het
Susd5	T	C	9: 114,082,504	Y161H	possibly damaging	Het
Syne3	A	G	12: 104,959,395		probably null	Het
Tbcd	G	C	11: 121,496,853		probably benign	Het
Tmc1	A	T	19: 20,900,851	N93K	probably benign	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Tmem131l	A	T	3: 83,928,732	V690D	probably damaging	Het
Trim8	A	G	19: 46,515,464	Q485R	possibly damaging	Het
Vmn2r63	A	T	7: 42,928,495	H206Q	probably benign	Het
Vmn2r77	T	A	7: 86,802,942	N443K	possibly damaging	Het
Zan	T	A	5: 137,389,316	I4878F	unknown	Het
Zfand4	A	G	6: 116,314,080	D344G	probably benign	Het

Other mutations in Sez6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01125:Sez6	APN	11	77977289	splice site	probably benign
IGL01142:Sez6	APN	11	77973816	missense	probably damaging	1.00
IGL02252:Sez6	APN	11	77974513	missense	probably damaging	1.00
IGL02332:Sez6	APN	11	77954742	splice site	probably benign
IGL02366:Sez6	APN	11	77976882	missense	probably damaging	0.98
IGL02479:Sez6	APN	11	77978026	missense	possibly damaging	0.84
IGL02963:Sez6	APN	11	77962949	missense	possibly damaging	0.93
velum	UTSW	11	77974549	missense	probably damaging	1.00
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0089:Sez6	UTSW	11	77974344	splice site	probably benign
R0485:Sez6	UTSW	11	77953813	missense	probably damaging	1.00
R0598:Sez6	UTSW	11	77977821	missense	possibly damaging	0.88
R0729:Sez6	UTSW	11	77976585	missense	probably benign	0.01
R1117:Sez6	UTSW	11	77974514	missense	probably damaging	1.00
R1199:Sez6	UTSW	11	77953885	missense	probably benign
R1534:Sez6	UTSW	11	77963045	missense	probably damaging	1.00
R1835:Sez6	UTSW	11	77953503	missense	probably benign
R1840:Sez6	UTSW	11	77953717	missense	possibly damaging	0.79
R1929:Sez6	UTSW	11	77972932	missense	probably damaging	1.00
R1970:Sez6	UTSW	11	77954068	critical splice donor site	probably null
R3156:Sez6	UTSW	11	77953779	missense	possibly damaging	0.63
R3930:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R3931:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R4894:Sez6	UTSW	11	77975260	missense	probably damaging	1.00
R4904:Sez6	UTSW	11	77975254	missense	probably damaging	1.00
R5026:Sez6	UTSW	11	77968989	missense	probably damaging	1.00
R5040:Sez6	UTSW	11	77969089	critical splice donor site	probably null
R5057:Sez6	UTSW	11	77973153	missense	probably damaging	1.00
R5093:Sez6	UTSW	11	77976562	missense	possibly damaging	0.88
R5640:Sez6	UTSW	11	77973759	intron	probably benign
R6013:Sez6	UTSW	11	77973797	missense	probably damaging	1.00
R6126:Sez6	UTSW	11	77973804	missense	probably damaging	1.00
R6153:Sez6	UTSW	11	77977822	missense	probably damaging	0.99
R6279:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6300:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6475:Sez6	UTSW	11	77973844
R6722:Sez6	UTSW	11	77953702	missense	probably damaging	1.00
R6897:Sez6	UTSW	11	77953559	missense	probably damaging	1.00
R6910:Sez6	UTSW	11	77953869	missense	possibly damaging	0.85
R7012:Sez6	UTSW	11	77977795	missense	probably benign	0.04
R7233:Sez6	UTSW	11	77973137	missense	probably damaging	1.00
R7265:Sez6	UTSW	11	77962865	missense	probably damaging	0.96
R7289:Sez6	UTSW	11	77974323	missense	possibly damaging	0.96
R7405:Sez6	UTSW	11	77962891	missense	probably benign	0.10
R7408:Sez6	UTSW	11	77953530	missense	probably damaging	1.00
R7485:Sez6	UTSW	11	77973885	missense	probably benign	0.01
R7592:Sez6	UTSW	11	77978050	missense	probably damaging	0.99
R7778:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7793:Sez6	UTSW	11	77977600	missense	probably damaging	1.00
R7818:Sez6	UTSW	11	77976902	missense	probably damaging	1.00
R7824:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7980:Sez6	UTSW	11	77953842	missense	probably benign	0.34
R8008:Sez6	UTSW	11	77973256	nonsense	probably null
R8840:Sez6	UTSW	11	77976487	missense	probably damaging	1.00
R8947:Sez6	UTSW	11	77953527	missense	probably damaging	1.00
R9040:Sez6	UTSW	11	77973936	missense	probably benign
R9081:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9082:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9092:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9094:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9095:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9097:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9169:Sez6	UTSW	11	77977647	missense	probably damaging	0.96
R9513:Sez6	UTSW	11	77974583	missense	probably damaging	1.00
R9630:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9632:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9646:Sez6	UTSW	11	77976806	missense	probably damaging	0.99
R9709:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
X0013:Sez6	UTSW	11	77954780	missense	probably benign	0.01
X0067:Sez6	UTSW	11	77974438	critical splice acceptor site	probably null
Z1088:Sez6	UTSW	11	77973197	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGGACATCCGAGTGTGAGTGAC -3'
(R):5'- GTGATACATGGCACCTTCCC -3'

Sequencing Primer
(F):5'- TGAGACTGGGGACACCTCTAGTC -3'
(R):5'- CAGGTTCCCCGTGTCTGACAG -3'

Posted On

2021-10-11