Mutagenetix > Incidental Mutation

Incidental Mutation 'R8973:Adamts16'

683268

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16

Synonyms

MMRRC Submission

068807-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70727802-70841811 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70738840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 975 (I975N)

Ref Sequence

ENSEMBL: ENSMUSP00000079041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

probably benign
Transcript: ENSMUST00000080145
AA Change: I975N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: I975N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123552

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	T	G	18: 57,592,067	L123V	possibly damaging	Het
1810022K09Rik	C	T	3: 14,607,245	V97I	probably benign	Het
2410089E03Rik	T	C	15: 8,203,793	W1201R	probably damaging	Het
4930404N11Rik	T	C	10: 81,364,015	D129G	unknown	Het
Adcy8	A	G	15: 64,699,135	*1250Q	probably null	Het
Anapc1	A	T	2: 128,664,032	I628N	probably damaging	Het
Ankrd39	C	T	1: 36,539,358		probably benign	Het
Ankub1	A	T	3: 57,665,511	S263R	possibly damaging	Het
Aoah	A	G	13: 20,840,155	I94V	probably benign	Het
Aox2	A	G	1: 58,289,954	D186G	probably benign	Het
Arap2	A	T	5: 62,698,325	C589*	probably null	Het
Armt1	T	C	10: 4,439,550	L69P	probably damaging	Het
Atxn7l3	T	A	11: 102,292,772	Y185F	probably benign	Het
BC067074	A	G	13: 113,319,759	T780A		Het
Cacna2d4	A	G	6: 119,241,181	D159G	probably damaging	Het
Camta2	C	A	11: 70,670,358	R1184L	probably benign	Het
Ccr7	G	A	11: 99,145,823	T91I	probably damaging	Het
Cdh9	A	G	15: 16,831,045	T323A	possibly damaging	Het
Cep250	C	T	2: 155,970,122	A446V	unknown	Het
Clec2e	C	A	6: 129,093,411	G216*	probably null	Het
Col25a1	T	C	3: 130,475,626	S176P	unknown	Het
Col4a3	A	C	1: 82,715,331	I1446L	probably benign	Het
Cse1l	A	G	2: 166,943,080	E823G	probably damaging	Het
Dchs2	A	G	3: 83,354,456	E2677G	possibly damaging	Het
Dis3l	T	C	9: 64,339,542	E77G	probably damaging	Het
Dnah6	T	C	6: 73,144,751	D1416G	probably benign	Het
Dpyd	T	C	3: 119,314,933		probably null	Het
Dst	A	G	1: 34,228,855	D3112G	probably damaging	Het
Dusp13	A	C	14: 21,734,906	N128K	probably benign	Het
Emilin2	T	G	17: 71,275,084	K216Q	probably benign	Het
Enam	T	C	5: 88,494,088	W254R	possibly damaging	Het
Esrrg	A	C	1: 188,198,750	N346T	possibly damaging	Het
Fbn2	C	T	18: 58,153,856	G244R	probably damaging	Het
Fbxw25	A	G	9: 109,650,064	L373P		Het
Gm21060	C	A	19: 61,296,928	V48L	possibly damaging	Het
Gm30302	A	T	13: 49,788,239	D80E	probably benign	Het
Gtpbp3	T	C	8: 71,491,162	V254A	possibly damaging	Het
H2-DMb2	A	G	17: 34,148,725	D171G	probably damaging	Het
Hrg	A	T	16: 22,959,218	T242S	probably benign	Het
Inf2	G	T	12: 112,607,515	C751F	unknown	Het
Krt13	A	T	11: 100,119,438	M239K	possibly damaging	Het
Lrrc72	A	G	12: 36,253,294	S7P	probably benign	Het
Matn2	A	G	15: 34,433,050	I867V	probably benign	Het
Mdh2	C	T	5: 135,790,165	A325V	possibly damaging	Het
Mki67	C	A	7: 135,695,635	A2557S	possibly damaging	Het
Mrpl16	A	T	19: 11,772,943	R64*	probably null	Het
Nav1	T	C	1: 135,584,725	D199G	probably benign	Het
Nbn	T	C	4: 15,986,585	V662A	probably damaging	Het
Nek10	G	A	14: 14,931,321		probably null	Het
Olfr141	C	A	2: 86,806,856	V48F	probably benign	Het
Olfr298	A	G	7: 86,489,279	S91P	probably damaging	Het
Olfr834	C	A	9: 18,988,678	S230*	probably null	Het
Olfr884	T	A	9: 38,047,543	V107D	possibly damaging	Het
Pcsk7	T	G	9: 45,927,642	S617R	probably benign	Het
Pde10a	C	A	17: 8,924,239	Q6K	probably benign	Het
Pigq	A	C	17: 25,932,167	M396R	probably damaging	Het
Pkhd1l1	T	A	15: 44,586,437	D3865E	probably damaging	Het
Prag1	C	T	8: 36,099,590		probably benign	Het
Rint1	A	G	5: 23,811,730	T498A	probably benign	Het
Rnf213	T	A	11: 119,461,930	F3921I		Het
Rpp14	A	G	14: 8,088,768	S95G	probably benign	Het
Ryk	T	G	9: 102,861,921	Y78D	possibly damaging	Het
Sez6	A	T	11: 77,974,571	Q678L	probably damaging	Het
Slc22a21	T	C	11: 53,969,576	K141E	probably damaging	Het
Slc30a5	A	T	13: 100,806,694	I609K	probably damaging	Het
Slc44a4	T	C	17: 34,921,562	F244L	probably damaging	Het
Susd5	T	C	9: 114,082,504	Y161H	possibly damaging	Het
Syne3	A	G	12: 104,959,395		probably null	Het
Tbcd	G	C	11: 121,496,853		probably benign	Het
Tmc1	A	T	19: 20,900,851	N93K	probably benign	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Tmem131l	A	T	3: 83,928,732	V690D	probably damaging	Het
Trim8	A	G	19: 46,515,464	Q485R	possibly damaging	Het
Vmn2r63	A	T	7: 42,928,495	H206Q	probably benign	Het
Vmn2r77	T	A	7: 86,802,942	N443K	possibly damaging	Het
Zan	T	A	5: 137,389,316	I4878F	unknown	Het
Zfand4	A	G	6: 116,314,080	D344G	probably benign	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70795484	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70836115	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70793141	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70800961	nonsense	probably null
IGL01874:Adamts16	APN	13	70768704	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70787147	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70772929	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70738585	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70738585	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70787170	splice site	probably benign
IGL02450:Adamts16	APN	13	70836300	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70738778	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70753291	missense	probably benign	0.00
swap	UTSW	13	70779518	critical splice donor site	probably benign
switcheroo	UTSW	13	70800954	missense	probably benign
R0046:Adamts16	UTSW	13	70763460	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70763460	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70779644	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70779611	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70791794	critical splice donor site	probably benign
R0369:Adamts16	UTSW	13	70779552	missense	possibly damaging	0.94
R0422:Adamts16	UTSW	13	70738955	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70768647	missense	probably benign
R0524:Adamts16	UTSW	13	70800894	missense	probably benign	0.00
R0590:Adamts16	UTSW	13	70800954	missense	probably benign
R0734:Adamts16	UTSW	13	70738481	splice site	probably benign
R0787:Adamts16	UTSW	13	70738829	missense	probably damaging	1.00
R0826:Adamts16	UTSW	13	70768692	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70763561	splice site	probably benign
R1027:Adamts16	UTSW	13	70767802	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70836134	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70836134	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70791794	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70798035	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70779598	splice site	probably null
R1869:Adamts16	UTSW	13	70735747	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70791886	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70753267	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70801007	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R3410:Adamts16	UTSW	13	70753226	missense	probably benign	0.00
R3411:Adamts16	UTSW	13	70753226	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70738891	missense	possibly damaging	0.92
R4117:Adamts16	UTSW	13	70767992	missense	probably benign	0.01
R4435:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70779624	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R5350:Adamts16	UTSW	13	70753196	nonsense	probably null
R5464:Adamts16	UTSW	13	70761749	missense	probably benign	0.01
R5613:Adamts16	UTSW	13	70730134	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70836375	nonsense	probably null
R5735:Adamts16	UTSW	13	70836218	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70738498	missense	probably damaging	1.00
R5907:Adamts16	UTSW	13	70728910	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70770274	nonsense	probably null
R6351:Adamts16	UTSW	13	70836203	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70779570	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70728898	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70768520	splice site	probably null
R6996:Adamts16	UTSW	13	70798038	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70772955	nonsense	probably null
R7356:Adamts16	UTSW	13	70836280	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70787164	missense	probably damaging	1.00
R7595:Adamts16	UTSW	13	70730115	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70836146	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70738582	missense	probably benign
R8231:Adamts16	UTSW	13	70777480	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70793098	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70836377	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70738675	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70836334	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70793188	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70791791	splice site	probably benign
R9132:Adamts16	UTSW	13	70753289	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70735829	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70753289	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70800926	missense	probably damaging	1.00
R9584:Adamts16	UTSW	13	70801017	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70761773	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGTCCTTGAGCACTGCATAAG -3'
(R):5'- CACTGGAAAACCATGGGCATC -3'

Sequencing Primer
(F):5'- TCCTTGAGCACTGCATAAGAGAGC -3'
(R):5'- CTGGAAAACCATGGGCATCTGTTAC -3'

Posted On

2021-10-11