Mutagenetix > Incidental Mutation

Incidental Mutation 'R8973:Nek10'

683272

Institutional Source

Beutler Lab

Gene Symbol

Nek10

Ensembl Gene

ENSMUSG00000042567

Gene Name

NIMA (never in mitosis gene a)- related kinase 10

Synonyms

LOC238944

MMRRC Submission

068807-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8973 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14803415-15012059 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 14931321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]

AlphaFold

Q3UGM2

Predicted Effect

probably null
Transcript: ENSMUST00000112630

SMART Domains

Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567

Domain	Start	End	E-Value	Type
ARM	197	238	8.23e1	SMART
ARM	278	320	5.18e0	SMART
low complexity region	387	400	N/A	INTRINSIC
ARM	401	448	7.09e1	SMART
S_TKc	519	791	2.36e-75	SMART
low complexity region	799	811	N/A	INTRINSIC
low complexity region	839	863	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112631

SMART Domains

Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567

Domain	Start	End	E-Value	Type
ARM	197	238	8.23e1	SMART
ARM	278	320	5.18e0	SMART
low complexity region	387	400	N/A	INTRINSIC
ARM	401	448	7.09e1	SMART
S_TKc	519	791	2.36e-75	SMART
low complexity region	799	811	N/A	INTRINSIC
low complexity region	839	863	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136826

SMART Domains

Protein: ENSMUSP00000123151
Gene: ENSMUSG00000042567

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	87	5.1e-13	PFAM
Pfam:Pkinase_Tyr	1	87	4.2e-8	PFAM
low complexity region	103	115	N/A	INTRINSIC
low complexity region	143	167	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	257	268	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224491

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (77/77)

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	T	G	18: 57,592,067	L123V	possibly damaging	Het
1810022K09Rik	C	T	3: 14,607,245	V97I	probably benign	Het
2410089E03Rik	T	C	15: 8,203,793	W1201R	probably damaging	Het
4930404N11Rik	T	C	10: 81,364,015	D129G	unknown	Het
Adamts16	A	T	13: 70,738,840	I975N	probably benign	Het
Adcy8	A	G	15: 64,699,135	*1250Q	probably null	Het
Anapc1	A	T	2: 128,664,032	I628N	probably damaging	Het
Ankrd39	C	T	1: 36,539,358		probably benign	Het
Ankub1	A	T	3: 57,665,511	S263R	possibly damaging	Het
Aoah	A	G	13: 20,840,155	I94V	probably benign	Het
Aox2	A	G	1: 58,289,954	D186G	probably benign	Het
Arap2	A	T	5: 62,698,325	C589*	probably null	Het
Armt1	T	C	10: 4,439,550	L69P	probably damaging	Het
Atxn7l3	T	A	11: 102,292,772	Y185F	probably benign	Het
BC067074	A	G	13: 113,319,759	T780A		Het
Cacna2d4	A	G	6: 119,241,181	D159G	probably damaging	Het
Camta2	C	A	11: 70,670,358	R1184L	probably benign	Het
Ccr7	G	A	11: 99,145,823	T91I	probably damaging	Het
Cdh9	A	G	15: 16,831,045	T323A	possibly damaging	Het
Cep250	C	T	2: 155,970,122	A446V	unknown	Het
Clec2e	C	A	6: 129,093,411	G216*	probably null	Het
Col25a1	T	C	3: 130,475,626	S176P	unknown	Het
Col4a3	A	C	1: 82,715,331	I1446L	probably benign	Het
Cse1l	A	G	2: 166,943,080	E823G	probably damaging	Het
Dchs2	A	G	3: 83,354,456	E2677G	possibly damaging	Het
Dis3l	T	C	9: 64,339,542	E77G	probably damaging	Het
Dnah6	T	C	6: 73,144,751	D1416G	probably benign	Het
Dpyd	T	C	3: 119,314,933		probably null	Het
Dst	A	G	1: 34,228,855	D3112G	probably damaging	Het
Dusp13	A	C	14: 21,734,906	N128K	probably benign	Het
Emilin2	T	G	17: 71,275,084	K216Q	probably benign	Het
Enam	T	C	5: 88,494,088	W254R	possibly damaging	Het
Esrrg	A	C	1: 188,198,750	N346T	possibly damaging	Het
Fbn2	C	T	18: 58,153,856	G244R	probably damaging	Het
Fbxw25	A	G	9: 109,650,064	L373P		Het
Gm21060	C	A	19: 61,296,928	V48L	possibly damaging	Het
Gm30302	A	T	13: 49,788,239	D80E	probably benign	Het
Gtpbp3	T	C	8: 71,491,162	V254A	possibly damaging	Het
H2-DMb2	A	G	17: 34,148,725	D171G	probably damaging	Het
Hrg	A	T	16: 22,959,218	T242S	probably benign	Het
Inf2	G	T	12: 112,607,515	C751F	unknown	Het
Krt13	A	T	11: 100,119,438	M239K	possibly damaging	Het
Lrrc72	A	G	12: 36,253,294	S7P	probably benign	Het
Matn2	A	G	15: 34,433,050	I867V	probably benign	Het
Mdh2	C	T	5: 135,790,165	A325V	possibly damaging	Het
Mki67	C	A	7: 135,695,635	A2557S	possibly damaging	Het
Mrpl16	A	T	19: 11,772,943	R64*	probably null	Het
Nav1	T	C	1: 135,584,725	D199G	probably benign	Het
Nbn	T	C	4: 15,986,585	V662A	probably damaging	Het
Olfr141	C	A	2: 86,806,856	V48F	probably benign	Het
Olfr298	A	G	7: 86,489,279	S91P	probably damaging	Het
Olfr834	C	A	9: 18,988,678	S230*	probably null	Het
Olfr884	T	A	9: 38,047,543	V107D	possibly damaging	Het
Pcsk7	T	G	9: 45,927,642	S617R	probably benign	Het
Pde10a	C	A	17: 8,924,239	Q6K	probably benign	Het
Pigq	A	C	17: 25,932,167	M396R	probably damaging	Het
Pkhd1l1	T	A	15: 44,586,437	D3865E	probably damaging	Het
Prag1	C	T	8: 36,099,590		probably benign	Het
Rint1	A	G	5: 23,811,730	T498A	probably benign	Het
Rnf213	T	A	11: 119,461,930	F3921I		Het
Rpp14	A	G	14: 8,088,768	S95G	probably benign	Het
Ryk	T	G	9: 102,861,921	Y78D	possibly damaging	Het
Sez6	A	T	11: 77,974,571	Q678L	probably damaging	Het
Slc22a21	T	C	11: 53,969,576	K141E	probably damaging	Het
Slc30a5	A	T	13: 100,806,694	I609K	probably damaging	Het
Slc44a4	T	C	17: 34,921,562	F244L	probably damaging	Het
Susd5	T	C	9: 114,082,504	Y161H	possibly damaging	Het
Syne3	A	G	12: 104,959,395		probably null	Het
Tbcd	G	C	11: 121,496,853		probably benign	Het
Tmc1	A	T	19: 20,900,851	N93K	probably benign	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Tmem131l	A	T	3: 83,928,732	V690D	probably damaging	Het
Trim8	A	G	19: 46,515,464	Q485R	possibly damaging	Het
Vmn2r63	A	T	7: 42,928,495	H206Q	probably benign	Het
Vmn2r77	T	A	7: 86,802,942	N443K	possibly damaging	Het
Zan	T	A	5: 137,389,316	I4878F	unknown	Het
Zfand4	A	G	6: 116,314,080	D344G	probably benign	Het

Other mutations in Nek10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Nek10	APN	14	14850957	missense	probably damaging	0.99
IGL02067:Nek10	APN	14	14861639	missense	probably benign	0.12
IGL02361:Nek10	APN	14	14843856	missense	probably damaging	1.00
IGL02687:Nek10	APN	14	14840570	missense	probably damaging	1.00
IGL02929:Nek10	APN	14	14821119	missense	possibly damaging	0.82
IGL03229:Nek10	APN	14	14986686	missense	probably benign	0.10
P0041:Nek10	UTSW	14	14861603	missense	probably benign	0.01
R0007:Nek10	UTSW	14	14840574	missense	probably benign	0.10
R0007:Nek10	UTSW	14	14840574	missense	probably benign	0.10
R0142:Nek10	UTSW	14	14861560	missense	possibly damaging	0.96
R0433:Nek10	UTSW	14	14860927	missense	probably benign	0.32
R0633:Nek10	UTSW	14	14857782	critical splice acceptor site	probably null
R1087:Nek10	UTSW	14	14827059	missense	possibly damaging	0.59
R1184:Nek10	UTSW	14	14931325	splice site	probably benign
R1250:Nek10	UTSW	14	14853887	missense	probably damaging	1.00
R1371:Nek10	UTSW	14	14850983	missense	probably damaging	0.98
R1506:Nek10	UTSW	14	14999078	splice site	probably benign
R1829:Nek10	UTSW	14	14863454	critical splice acceptor site	probably null
R1831:Nek10	UTSW	14	14842789	missense	probably benign
R1833:Nek10	UTSW	14	14842789	missense	probably benign
R1990:Nek10	UTSW	14	14860764	missense	probably benign
R1997:Nek10	UTSW	14	14827003	missense	probably benign	0.09
R2011:Nek10	UTSW	14	14885122	missense	probably damaging	1.00
R2158:Nek10	UTSW	14	14885047	splice site	probably null
R2288:Nek10	UTSW	14	14853956	nonsense	probably null
R2568:Nek10	UTSW	14	14999112	missense	possibly damaging	0.89
R2907:Nek10	UTSW	14	14980613	missense	possibly damaging	0.81
R2965:Nek10	UTSW	14	14836202	missense	probably damaging	1.00
R3922:Nek10	UTSW	14	14861585	missense	possibly damaging	0.88
R4032:Nek10	UTSW	14	14853877	splice site	probably null
R4700:Nek10	UTSW	14	14842841	missense	possibly damaging	0.69
R4742:Nek10	UTSW	14	14861624	missense	probably null	0.03
R4785:Nek10	UTSW	14	14855714	missense	probably benign
R4890:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4891:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4920:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4924:Nek10	UTSW	14	14846594	splice site	probably null
R4928:Nek10	UTSW	14	14930577	missense	probably damaging	1.00
R4948:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4952:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4953:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R5092:Nek10	UTSW	14	14820851	missense	possibly damaging	0.81
R5097:Nek10	UTSW	14	14857851	missense	probably benign	0.00
R5593:Nek10	UTSW	14	14980544	nonsense	probably null
R5696:Nek10	UTSW	14	14860736	splice site	probably null
R5813:Nek10	UTSW	14	14986704	missense	probably benign	0.01
R5829:Nek10	UTSW	14	14865404	missense	probably damaging	1.00
R5872:Nek10	UTSW	14	14850896	missense	probably benign	0.06
R5939:Nek10	UTSW	14	14931290	missense	possibly damaging	0.58
R6025:Nek10	UTSW	14	14865633	missense	probably benign	0.41
R6235:Nek10	UTSW	14	14821113	nonsense	probably null
R6539:Nek10	UTSW	14	14860789	missense	possibly damaging	0.94
R6542:Nek10	UTSW	14	14999108	missense	probably benign	0.44
R6561:Nek10	UTSW	14	14828448	missense	possibly damaging	0.48
R6659:Nek10	UTSW	14	14861684	missense	probably benign	0.29
R7039:Nek10	UTSW	14	14826946	missense	possibly damaging	0.63
R7039:Nek10	UTSW	14	14986700	missense	probably damaging	0.99
R7102:Nek10	UTSW	14	14828517	missense	probably damaging	1.00
R7185:Nek10	UTSW	14	14846621	missense	probably benign	0.03
R7198:Nek10	UTSW	14	14850947	missense	probably damaging	0.99
R7202:Nek10	UTSW	14	14836171	missense	probably benign	0.01
R7251:Nek10	UTSW	14	14853965	missense	probably benign
R7345:Nek10	UTSW	14	14955503	missense	probably benign
R7590:Nek10	UTSW	14	15006693	makesense	probably null
R7593:Nek10	UTSW	14	14826955	missense	probably benign	0.04
R7616:Nek10	UTSW	14	14937759	missense	probably benign	0.27
R7635:Nek10	UTSW	14	14850932	missense	probably benign	0.01
R7817:Nek10	UTSW	14	15001017	missense	probably benign	0.00
R7826:Nek10	UTSW	14	14860846	splice site	probably null
R7986:Nek10	UTSW	14	15001020	missense	probably benign	0.17
R8765:Nek10	UTSW	14	14999104	missense	probably damaging	0.97
R8856:Nek10	UTSW	14	14937610	missense	probably damaging	0.96
R9002:Nek10	UTSW	14	14980590	missense	probably damaging	1.00
R9088:Nek10	UTSW	14	14931314	missense	probably damaging	1.00
R9195:Nek10	UTSW	14	14821139	missense	probably benign	0.03
R9464:Nek10	UTSW	14	14937766	missense	probably benign
R9511:Nek10	UTSW	14	14828511	missense	probably benign	0.05
R9529:Nek10	UTSW	14	14850833	missense	probably benign
R9590:Nek10	UTSW	14	14853888	missense	probably damaging	1.00
Z1177:Nek10	UTSW	14	14853948	missense	probably benign	0.00
Z1177:Nek10	UTSW	14	15001157	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAACTGGCTAACTTGCACTG -3'
(R):5'- CCCAGTGGTTTTCAAGGAGACAC -3'

Sequencing Primer
(F):5'- GAACTGGCTAACTTGCACTGATTTTC -3'
(R):5'- GTGGTTTTCAAGGAGACACTATTAC -3'

Posted On

2021-10-11