Incidental Mutation 'R8973:Pkhd1l1'
ID 683277
Institutional Source Beutler Lab
Gene Symbol Pkhd1l1
Ensembl Gene ENSMUSG00000038725
Gene Name polycystic kidney and hepatic disease 1-like 1
Synonyms fibrocystin L, D86 mRNA, PKHDL1
MMRRC Submission 068807-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8973 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 44320890-44464765 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44449833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3865 (D3865E)
Ref Sequence ENSEMBL: ENSMUSP00000036988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000038336
AA Change: D3865E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: D3865E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 1.6e-16 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1322 1.1e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 5.1e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 2.1e-10 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166957
AA Change: D3865E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: D3865E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 9.4e-18 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1323 3e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 3.7e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 9.7e-12 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209244
AA Change: D3865E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 A T 13: 70,886,959 (GRCm39) I975N probably benign Het
Adcy8 A G 15: 64,570,984 (GRCm39) *1250Q probably null Het
Anapc1 A T 2: 128,505,952 (GRCm39) I628N probably damaging Het
Ankrd39 C T 1: 36,578,439 (GRCm39) probably benign Het
Ankub1 A T 3: 57,572,932 (GRCm39) S263R possibly damaging Het
Aoah A G 13: 21,024,325 (GRCm39) I94V probably benign Het
Aox1 A G 1: 58,329,113 (GRCm39) D186G probably benign Het
Arap2 A T 5: 62,855,668 (GRCm39) C589* probably null Het
Armt1 T C 10: 4,389,550 (GRCm39) L69P probably damaging Het
Atxn7l3 T A 11: 102,183,598 (GRCm39) Y185F probably benign Het
Cacna2d4 A G 6: 119,218,142 (GRCm39) D159G probably damaging Het
Camta2 C A 11: 70,561,184 (GRCm39) R1184L probably benign Het
Ccdc192 T G 18: 57,725,139 (GRCm39) L123V possibly damaging Het
Ccr7 G A 11: 99,036,649 (GRCm39) T91I probably damaging Het
Cdh9 A G 15: 16,831,131 (GRCm39) T323A possibly damaging Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Clec2e C A 6: 129,070,374 (GRCm39) G216* probably null Het
Col25a1 T C 3: 130,269,275 (GRCm39) S176P unknown Het
Col4a3 A C 1: 82,693,052 (GRCm39) I1446L probably benign Het
Cplane1 T C 15: 8,233,277 (GRCm39) W1201R probably damaging Het
Cse1l A G 2: 166,785,000 (GRCm39) E823G probably damaging Het
Cspg4b A G 13: 113,456,293 (GRCm39) T780A Het
Dchs2 A G 3: 83,261,763 (GRCm39) E2677G possibly damaging Het
Dis3l T C 9: 64,246,824 (GRCm39) E77G probably damaging Het
Dnah6 T C 6: 73,121,734 (GRCm39) D1416G probably benign Het
Dpyd T C 3: 119,108,582 (GRCm39) probably null Het
Dst A G 1: 34,267,936 (GRCm39) D3112G probably damaging Het
Dusp13b A C 14: 21,784,974 (GRCm39) N128K probably benign Het
Emilin2 T G 17: 71,582,079 (GRCm39) K216Q probably benign Het
Enam T C 5: 88,641,947 (GRCm39) W254R possibly damaging Het
Esrrg A C 1: 187,930,947 (GRCm39) N346T possibly damaging Het
Fbn2 C T 18: 58,286,928 (GRCm39) G244R probably damaging Het
Fbxw25 A G 9: 109,479,132 (GRCm39) L373P Het
Gm21060 C A 19: 61,285,366 (GRCm39) V48L possibly damaging Het
Gtpbp3 T C 8: 71,943,806 (GRCm39) V254A possibly damaging Het
H2-DMb2 A G 17: 34,367,699 (GRCm39) D171G probably damaging Het
Hrg A T 16: 22,777,968 (GRCm39) T242S probably benign Het
Inf2 G T 12: 112,573,949 (GRCm39) C751F unknown Het
Krt13 A T 11: 100,010,264 (GRCm39) M239K possibly damaging Het
Lrrc72 A G 12: 36,303,293 (GRCm39) S7P probably benign Het
Matn2 A G 15: 34,433,196 (GRCm39) I867V probably benign Het
Mdh2 C T 5: 135,819,019 (GRCm39) A325V possibly damaging Het
Mki67 C A 7: 135,297,364 (GRCm39) A2557S possibly damaging Het
Mrpl16 A T 19: 11,750,307 (GRCm39) R64* probably null Het
Nav1 T C 1: 135,512,463 (GRCm39) D199G probably benign Het
Nbn T C 4: 15,986,585 (GRCm39) V662A probably damaging Het
Nek10 G A 14: 14,931,321 (GRCm38) probably null Het
Or14a257 A G 7: 86,138,487 (GRCm39) S91P probably damaging Het
Or5t18 C A 2: 86,637,200 (GRCm39) V48F probably benign Het
Or7g12 C A 9: 18,899,974 (GRCm39) S230* probably null Het
Or8b37 T A 9: 37,958,839 (GRCm39) V107D possibly damaging Het
Pcsk7 T G 9: 45,838,940 (GRCm39) S617R probably benign Het
Pde10a C A 17: 9,143,071 (GRCm39) Q6K probably benign Het
Pigq A C 17: 26,151,141 (GRCm39) M396R probably damaging Het
Prag1 C T 8: 36,566,744 (GRCm39) probably benign Het
Rbis C T 3: 14,672,305 (GRCm39) V97I probably benign Het
Rint1 A G 5: 24,016,728 (GRCm39) T498A probably benign Het
Rnf213 T A 11: 119,352,756 (GRCm39) F3921I Het
Rpp14 A G 14: 8,088,768 (GRCm38) S95G probably benign Het
Ryk T G 9: 102,739,120 (GRCm39) Y78D possibly damaging Het
Sez6 A T 11: 77,865,397 (GRCm39) Q678L probably damaging Het
Slc22a21 T C 11: 53,860,402 (GRCm39) K141E probably damaging Het
Slc30a5 A T 13: 100,943,202 (GRCm39) I609K probably damaging Het
Slc44a4 T C 17: 35,140,538 (GRCm39) F244L probably damaging Het
Spata31e1 A T 13: 49,941,715 (GRCm39) D80E probably benign Het
Susd5 T C 9: 113,911,572 (GRCm39) Y161H possibly damaging Het
Syne3 A G 12: 104,925,654 (GRCm39) probably null Het
Tbcd G C 11: 121,387,679 (GRCm39) probably benign Het
Tektip1 T C 10: 81,199,849 (GRCm39) D129G unknown Het
Tmc1 A T 19: 20,878,215 (GRCm39) N93K probably benign Het
Tmem100 T A 11: 89,926,302 (GRCm39) M43K probably benign Het
Tmem131l A T 3: 83,836,039 (GRCm39) V690D probably damaging Het
Trim8 A G 19: 46,503,903 (GRCm39) Q485R possibly damaging Het
Vmn2r63 A T 7: 42,577,919 (GRCm39) H206Q probably benign Het
Vmn2r77 T A 7: 86,452,150 (GRCm39) N443K possibly damaging Het
Zan T A 5: 137,387,578 (GRCm39) I4878F unknown Het
Zfand4 A G 6: 116,291,041 (GRCm39) D344G probably benign Het
Other mutations in Pkhd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pkhd1l1 APN 15 44,340,982 (GRCm39) missense probably damaging 1.00
IGL00235:Pkhd1l1 APN 15 44,419,415 (GRCm39) missense probably damaging 1.00
IGL00264:Pkhd1l1 APN 15 44,354,425 (GRCm39) missense possibly damaging 0.67
IGL00537:Pkhd1l1 APN 15 44,455,388 (GRCm39) missense possibly damaging 0.88
IGL00537:Pkhd1l1 APN 15 44,363,443 (GRCm39) missense probably benign 0.42
IGL00580:Pkhd1l1 APN 15 44,449,870 (GRCm39) missense probably damaging 0.98
IGL01085:Pkhd1l1 APN 15 44,426,148 (GRCm39) splice site probably null
IGL01089:Pkhd1l1 APN 15 44,347,265 (GRCm39) splice site probably benign
IGL01094:Pkhd1l1 APN 15 44,410,325 (GRCm39) missense probably benign 0.09
IGL01120:Pkhd1l1 APN 15 44,368,708 (GRCm39) critical splice donor site probably null
IGL01307:Pkhd1l1 APN 15 44,393,425 (GRCm39) missense possibly damaging 0.82
IGL01362:Pkhd1l1 APN 15 44,396,378 (GRCm39) missense probably benign 0.00
IGL01403:Pkhd1l1 APN 15 44,347,229 (GRCm39) nonsense probably null
IGL01546:Pkhd1l1 APN 15 44,429,712 (GRCm39) missense probably damaging 1.00
IGL01596:Pkhd1l1 APN 15 44,392,806 (GRCm39) missense possibly damaging 0.50
IGL01696:Pkhd1l1 APN 15 44,392,747 (GRCm39) missense possibly damaging 0.79
IGL01844:Pkhd1l1 APN 15 44,362,796 (GRCm39) splice site probably benign
IGL02007:Pkhd1l1 APN 15 44,397,129 (GRCm39) splice site probably benign
IGL02041:Pkhd1l1 APN 15 44,356,452 (GRCm39) splice site probably null
IGL02171:Pkhd1l1 APN 15 44,379,542 (GRCm39) missense possibly damaging 0.80
IGL02206:Pkhd1l1 APN 15 44,376,245 (GRCm39) missense probably benign 0.08
IGL02266:Pkhd1l1 APN 15 44,437,010 (GRCm39) missense probably damaging 1.00
IGL02487:Pkhd1l1 APN 15 44,322,822 (GRCm39) missense possibly damaging 0.65
IGL02488:Pkhd1l1 APN 15 44,421,993 (GRCm39) missense probably benign
IGL02522:Pkhd1l1 APN 15 44,419,298 (GRCm39) missense possibly damaging 0.71
IGL02554:Pkhd1l1 APN 15 44,441,896 (GRCm39) missense probably damaging 1.00
IGL02566:Pkhd1l1 APN 15 44,389,450 (GRCm39) splice site probably null
IGL02602:Pkhd1l1 APN 15 44,421,327 (GRCm39) missense probably damaging 1.00
IGL02606:Pkhd1l1 APN 15 44,452,852 (GRCm39) missense probably benign 0.00
IGL02623:Pkhd1l1 APN 15 44,448,269 (GRCm39) missense probably damaging 1.00
IGL02634:Pkhd1l1 APN 15 44,403,063 (GRCm39) missense probably damaging 1.00
IGL02637:Pkhd1l1 APN 15 44,427,720 (GRCm39) missense probably damaging 1.00
IGL02651:Pkhd1l1 APN 15 44,347,210 (GRCm39) missense probably damaging 1.00
IGL02679:Pkhd1l1 APN 15 44,393,441 (GRCm39) critical splice donor site probably null
IGL02684:Pkhd1l1 APN 15 44,379,605 (GRCm39) critical splice donor site probably null
IGL02739:Pkhd1l1 APN 15 44,404,346 (GRCm39) missense probably benign 0.11
IGL02831:Pkhd1l1 APN 15 44,364,889 (GRCm39) missense probably benign 0.18
IGL02839:Pkhd1l1 APN 15 44,392,939 (GRCm39) missense probably damaging 0.98
IGL02944:Pkhd1l1 APN 15 44,364,927 (GRCm39) missense probably damaging 1.00
IGL02957:Pkhd1l1 APN 15 44,376,304 (GRCm39) missense probably damaging 1.00
IGL03001:Pkhd1l1 APN 15 44,421,400 (GRCm39) missense probably damaging 1.00
IGL03030:Pkhd1l1 APN 15 44,460,298 (GRCm39) missense probably benign 0.41
IGL03030:Pkhd1l1 APN 15 44,455,372 (GRCm39) missense probably benign 0.00
IGL03132:Pkhd1l1 APN 15 44,438,013 (GRCm39) missense probably damaging 1.00
IGL03194:Pkhd1l1 APN 15 44,381,531 (GRCm39) missense probably damaging 1.00
IGL03219:Pkhd1l1 APN 15 44,460,291 (GRCm39) missense possibly damaging 0.62
IGL03236:Pkhd1l1 APN 15 44,445,222 (GRCm39) missense probably damaging 1.00
IGL03266:Pkhd1l1 APN 15 44,402,348 (GRCm39) missense probably damaging 1.00
IGL03276:Pkhd1l1 APN 15 44,457,980 (GRCm39) missense possibly damaging 0.77
IGL03284:Pkhd1l1 APN 15 44,410,914 (GRCm39) splice site probably benign
IGL03377:Pkhd1l1 APN 15 44,347,747 (GRCm39) splice site probably null
R0310_Pkhd1l1_251 UTSW 15 44,386,134 (GRCm39) splice site probably benign
R0344_Pkhd1l1_462 UTSW 15 44,460,407 (GRCm39) missense probably benign 0.15
R1737_Pkhd1l1_815 UTSW 15 44,410,905 (GRCm39) critical splice donor site probably null
R5049_Pkhd1l1_556 UTSW 15 44,321,012 (GRCm39) missense probably benign 0.00
K7371:Pkhd1l1 UTSW 15 44,363,463 (GRCm39) missense possibly damaging 0.94
K7371:Pkhd1l1 UTSW 15 44,400,838 (GRCm39) missense possibly damaging 0.67
N/A - 287:Pkhd1l1 UTSW 15 44,445,654 (GRCm39) missense probably damaging 0.98
P4717OSA:Pkhd1l1 UTSW 15 44,391,643 (GRCm39) missense probably damaging 1.00
P4717OSA:Pkhd1l1 UTSW 15 44,386,895 (GRCm39) missense probably benign 0.17
R0007:Pkhd1l1 UTSW 15 44,437,794 (GRCm39) splice site probably benign
R0020:Pkhd1l1 UTSW 15 44,420,268 (GRCm39) missense probably damaging 1.00
R0034:Pkhd1l1 UTSW 15 44,367,405 (GRCm39) missense probably benign 0.00
R0040:Pkhd1l1 UTSW 15 44,437,021 (GRCm39) missense probably damaging 1.00
R0050:Pkhd1l1 UTSW 15 44,437,203 (GRCm39) missense possibly damaging 0.79
R0050:Pkhd1l1 UTSW 15 44,437,203 (GRCm39) missense possibly damaging 0.79
R0063:Pkhd1l1 UTSW 15 44,392,633 (GRCm39) missense probably damaging 1.00
R0063:Pkhd1l1 UTSW 15 44,392,633 (GRCm39) missense probably damaging 1.00
R0086:Pkhd1l1 UTSW 15 44,419,404 (GRCm39) missense possibly damaging 0.94
R0103:Pkhd1l1 UTSW 15 44,460,537 (GRCm39) missense probably benign
R0103:Pkhd1l1 UTSW 15 44,460,537 (GRCm39) missense probably benign
R0127:Pkhd1l1 UTSW 15 44,418,001 (GRCm39) missense probably damaging 0.99
R0226:Pkhd1l1 UTSW 15 44,390,180 (GRCm39) missense possibly damaging 0.65
R0268:Pkhd1l1 UTSW 15 44,460,407 (GRCm39) missense probably benign 0.15
R0294:Pkhd1l1 UTSW 15 44,423,831 (GRCm39) missense probably benign 0.05
R0310:Pkhd1l1 UTSW 15 44,386,134 (GRCm39) splice site probably benign
R0344:Pkhd1l1 UTSW 15 44,460,407 (GRCm39) missense probably benign 0.15
R0449:Pkhd1l1 UTSW 15 44,364,915 (GRCm39) missense probably damaging 1.00
R0492:Pkhd1l1 UTSW 15 44,383,086 (GRCm39) missense probably benign 0.03
R0505:Pkhd1l1 UTSW 15 44,452,814 (GRCm39) missense probably damaging 1.00
R0529:Pkhd1l1 UTSW 15 44,390,150 (GRCm39) missense possibly damaging 0.62
R0543:Pkhd1l1 UTSW 15 44,386,887 (GRCm39) critical splice acceptor site probably null
R0552:Pkhd1l1 UTSW 15 44,352,942 (GRCm39) missense probably damaging 0.98
R0558:Pkhd1l1 UTSW 15 44,347,820 (GRCm39) missense probably damaging 0.97
R0609:Pkhd1l1 UTSW 15 44,330,820 (GRCm39) missense possibly damaging 0.48
R0619:Pkhd1l1 UTSW 15 44,347,234 (GRCm39) missense probably damaging 1.00
R0727:Pkhd1l1 UTSW 15 44,399,184 (GRCm39) missense possibly damaging 0.80
R0787:Pkhd1l1 UTSW 15 44,392,660 (GRCm39) missense probably damaging 1.00
R0846:Pkhd1l1 UTSW 15 44,358,993 (GRCm39) missense probably damaging 1.00
R0909:Pkhd1l1 UTSW 15 44,402,279 (GRCm39) splice site probably null
R0942:Pkhd1l1 UTSW 15 44,396,355 (GRCm39) missense probably benign 0.01
R1056:Pkhd1l1 UTSW 15 44,455,360 (GRCm39) missense probably damaging 1.00
R1147:Pkhd1l1 UTSW 15 44,400,837 (GRCm39) missense probably null 0.15
R1147:Pkhd1l1 UTSW 15 44,400,837 (GRCm39) missense probably null 0.15
R1187:Pkhd1l1 UTSW 15 44,361,447 (GRCm39) missense possibly damaging 0.65
R1328:Pkhd1l1 UTSW 15 44,361,392 (GRCm39) missense probably benign 0.01
R1331:Pkhd1l1 UTSW 15 44,452,993 (GRCm39) missense probably damaging 1.00
R1331:Pkhd1l1 UTSW 15 44,368,943 (GRCm39) missense probably damaging 1.00
R1332:Pkhd1l1 UTSW 15 44,368,943 (GRCm39) missense probably damaging 1.00
R1335:Pkhd1l1 UTSW 15 44,368,943 (GRCm39) missense probably damaging 1.00
R1338:Pkhd1l1 UTSW 15 44,390,120 (GRCm39) missense probably damaging 1.00
R1440:Pkhd1l1 UTSW 15 44,404,384 (GRCm39) splice site probably benign
R1445:Pkhd1l1 UTSW 15 44,369,040 (GRCm39) missense probably benign 0.32
R1458:Pkhd1l1 UTSW 15 44,379,511 (GRCm39) missense probably benign 0.01
R1469:Pkhd1l1 UTSW 15 44,400,282 (GRCm39) missense probably benign 0.45
R1469:Pkhd1l1 UTSW 15 44,400,282 (GRCm39) missense probably benign 0.45
R1500:Pkhd1l1 UTSW 15 44,408,890 (GRCm39) missense probably damaging 1.00
R1528:Pkhd1l1 UTSW 15 44,390,120 (GRCm39) missense probably damaging 1.00
R1542:Pkhd1l1 UTSW 15 44,391,587 (GRCm39) missense probably benign 0.44
R1568:Pkhd1l1 UTSW 15 44,408,897 (GRCm39) splice site probably null
R1571:Pkhd1l1 UTSW 15 44,390,237 (GRCm39) missense probably benign
R1572:Pkhd1l1 UTSW 15 44,406,869 (GRCm39) missense probably benign 0.01
R1604:Pkhd1l1 UTSW 15 44,330,763 (GRCm39) nonsense probably null
R1638:Pkhd1l1 UTSW 15 44,460,513 (GRCm39) missense probably benign 0.06
R1639:Pkhd1l1 UTSW 15 44,404,351 (GRCm39) missense probably damaging 0.99
R1737:Pkhd1l1 UTSW 15 44,410,905 (GRCm39) critical splice donor site probably null
R1816:Pkhd1l1 UTSW 15 44,391,635 (GRCm39) missense possibly damaging 0.91
R1826:Pkhd1l1 UTSW 15 44,366,741 (GRCm39) missense possibly damaging 0.75
R1880:Pkhd1l1 UTSW 15 44,388,638 (GRCm39) missense probably benign 0.13
R1930:Pkhd1l1 UTSW 15 44,366,733 (GRCm39) missense possibly damaging 0.69
R1933:Pkhd1l1 UTSW 15 44,404,280 (GRCm39) missense possibly damaging 0.48
R1938:Pkhd1l1 UTSW 15 44,363,434 (GRCm39) missense probably benign
R1975:Pkhd1l1 UTSW 15 44,393,109 (GRCm39) missense probably damaging 1.00
R1999:Pkhd1l1 UTSW 15 44,363,378 (GRCm39) splice site probably null
R2037:Pkhd1l1 UTSW 15 44,431,617 (GRCm39) splice site probably null
R2045:Pkhd1l1 UTSW 15 44,343,050 (GRCm39) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,445,137 (GRCm39) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,410,909 (GRCm39) splice site probably benign
R2063:Pkhd1l1 UTSW 15 44,414,148 (GRCm39) missense possibly damaging 0.69
R2072:Pkhd1l1 UTSW 15 44,422,035 (GRCm39) missense probably damaging 1.00
R2073:Pkhd1l1 UTSW 15 44,422,035 (GRCm39) missense probably damaging 1.00
R2075:Pkhd1l1 UTSW 15 44,422,035 (GRCm39) missense probably damaging 1.00
R2078:Pkhd1l1 UTSW 15 44,391,163 (GRCm39) missense probably benign 0.08
R2116:Pkhd1l1 UTSW 15 44,432,878 (GRCm39) missense probably damaging 0.97
R2133:Pkhd1l1 UTSW 15 44,379,581 (GRCm39) missense possibly damaging 0.91
R2138:Pkhd1l1 UTSW 15 44,364,853 (GRCm39) missense probably damaging 1.00
R2139:Pkhd1l1 UTSW 15 44,393,214 (GRCm39) missense possibly damaging 0.46
R2145:Pkhd1l1 UTSW 15 44,376,273 (GRCm39) splice site probably null
R2150:Pkhd1l1 UTSW 15 44,363,378 (GRCm39) splice site probably null
R2177:Pkhd1l1 UTSW 15 44,322,791 (GRCm39) missense probably benign
R2184:Pkhd1l1 UTSW 15 44,362,692 (GRCm39) missense possibly damaging 0.89
R2216:Pkhd1l1 UTSW 15 44,437,291 (GRCm39) missense probably damaging 1.00
R2226:Pkhd1l1 UTSW 15 44,376,188 (GRCm39) missense possibly damaging 0.79
R2227:Pkhd1l1 UTSW 15 44,376,188 (GRCm39) missense possibly damaging 0.79
R2243:Pkhd1l1 UTSW 15 44,410,323 (GRCm39) missense probably damaging 1.00
R2290:Pkhd1l1 UTSW 15 44,391,646 (GRCm39) missense probably benign 0.03
R2294:Pkhd1l1 UTSW 15 44,343,003 (GRCm39) missense probably damaging 0.99
R2346:Pkhd1l1 UTSW 15 44,423,902 (GRCm39) missense possibly damaging 0.82
R2356:Pkhd1l1 UTSW 15 44,396,415 (GRCm39) missense probably benign 0.00
R2386:Pkhd1l1 UTSW 15 44,391,574 (GRCm39) missense probably benign 0.00
R2404:Pkhd1l1 UTSW 15 44,414,216 (GRCm39) missense probably damaging 1.00
R2504:Pkhd1l1 UTSW 15 44,348,824 (GRCm39) missense probably damaging 0.97
R2679:Pkhd1l1 UTSW 15 44,408,782 (GRCm39) missense probably damaging 0.99
R2860:Pkhd1l1 UTSW 15 44,404,267 (GRCm39) missense probably damaging 1.00
R2861:Pkhd1l1 UTSW 15 44,404,267 (GRCm39) missense probably damaging 1.00
R2862:Pkhd1l1 UTSW 15 44,404,267 (GRCm39) missense probably damaging 1.00
R2972:Pkhd1l1 UTSW 15 44,410,644 (GRCm39) missense possibly damaging 0.65
R3016:Pkhd1l1 UTSW 15 44,408,766 (GRCm39) missense probably benign 0.02
R3162:Pkhd1l1 UTSW 15 44,368,924 (GRCm39) missense probably damaging 1.00
R3162:Pkhd1l1 UTSW 15 44,368,924 (GRCm39) missense probably damaging 1.00
R3416:Pkhd1l1 UTSW 15 44,410,760 (GRCm39) missense probably damaging 1.00
R3623:Pkhd1l1 UTSW 15 44,390,265 (GRCm39) missense probably damaging 1.00
R3687:Pkhd1l1 UTSW 15 44,409,983 (GRCm39) missense probably benign 0.17
R3755:Pkhd1l1 UTSW 15 44,452,802 (GRCm39) missense probably damaging 1.00
R3776:Pkhd1l1 UTSW 15 44,378,371 (GRCm39) critical splice donor site probably null
R3803:Pkhd1l1 UTSW 15 44,356,531 (GRCm39) missense probably benign 0.25
R3942:Pkhd1l1 UTSW 15 44,455,422 (GRCm39) critical splice donor site probably null
R4010:Pkhd1l1 UTSW 15 44,392,496 (GRCm39) missense possibly damaging 0.80
R4049:Pkhd1l1 UTSW 15 44,361,953 (GRCm39) missense probably damaging 1.00
R4059:Pkhd1l1 UTSW 15 44,414,156 (GRCm39) missense probably benign 0.01
R4179:Pkhd1l1 UTSW 15 44,387,045 (GRCm39) missense probably benign 0.45
R4184:Pkhd1l1 UTSW 15 44,455,302 (GRCm39) missense probably benign 0.00
R4369:Pkhd1l1 UTSW 15 44,368,949 (GRCm39) missense probably benign 0.00
R4462:Pkhd1l1 UTSW 15 44,445,200 (GRCm39) missense probably damaging 1.00
R4551:Pkhd1l1 UTSW 15 44,414,281 (GRCm39) missense probably damaging 1.00
R4618:Pkhd1l1 UTSW 15 44,403,078 (GRCm39) missense probably damaging 1.00
R4632:Pkhd1l1 UTSW 15 44,347,796 (GRCm39) missense probably benign 0.07
R4657:Pkhd1l1 UTSW 15 44,410,743 (GRCm39) missense probably damaging 1.00
R4716:Pkhd1l1 UTSW 15 44,419,428 (GRCm39) missense probably damaging 1.00
R4788:Pkhd1l1 UTSW 15 44,361,417 (GRCm39) missense probably damaging 0.99
R4828:Pkhd1l1 UTSW 15 44,392,801 (GRCm39) missense possibly damaging 0.55
R4858:Pkhd1l1 UTSW 15 44,354,497 (GRCm39) missense probably damaging 0.99
R4860:Pkhd1l1 UTSW 15 44,400,774 (GRCm39) missense possibly damaging 0.77
R4860:Pkhd1l1 UTSW 15 44,400,774 (GRCm39) missense possibly damaging 0.77
R4951:Pkhd1l1 UTSW 15 44,397,287 (GRCm39) missense possibly damaging 0.82
R4963:Pkhd1l1 UTSW 15 44,367,421 (GRCm39) missense probably benign 0.00
R5023:Pkhd1l1 UTSW 15 44,391,587 (GRCm39) missense probably benign 0.44
R5023:Pkhd1l1 UTSW 15 44,445,623 (GRCm39) missense probably benign 0.00
R5035:Pkhd1l1 UTSW 15 44,431,720 (GRCm39) missense probably damaging 1.00
R5049:Pkhd1l1 UTSW 15 44,321,012 (GRCm39) missense probably benign 0.00
R5065:Pkhd1l1 UTSW 15 44,445,689 (GRCm39) missense possibly damaging 0.68
R5089:Pkhd1l1 UTSW 15 44,455,283 (GRCm39) missense probably benign 0.01
R5151:Pkhd1l1 UTSW 15 44,368,705 (GRCm39) missense probably benign 0.00
R5153:Pkhd1l1 UTSW 15 44,368,705 (GRCm39) missense probably benign 0.00
R5189:Pkhd1l1 UTSW 15 44,410,544 (GRCm39) missense probably damaging 1.00
R5204:Pkhd1l1 UTSW 15 44,410,437 (GRCm39) missense possibly damaging 0.51
R5216:Pkhd1l1 UTSW 15 44,359,043 (GRCm39) nonsense probably null
R5286:Pkhd1l1 UTSW 15 44,378,368 (GRCm39) nonsense probably null
R5292:Pkhd1l1 UTSW 15 44,392,962 (GRCm39) missense probably damaging 1.00
R5293:Pkhd1l1 UTSW 15 44,399,146 (GRCm39) missense probably benign 0.01
R5298:Pkhd1l1 UTSW 15 44,367,442 (GRCm39) missense probably benign 0.00
R5327:Pkhd1l1 UTSW 15 44,410,258 (GRCm39) missense probably damaging 1.00
R5346:Pkhd1l1 UTSW 15 44,404,363 (GRCm39) missense probably damaging 1.00
R5481:Pkhd1l1 UTSW 15 44,422,042 (GRCm39) missense probably damaging 1.00
R5645:Pkhd1l1 UTSW 15 44,396,388 (GRCm39) missense probably benign 0.18
R5718:Pkhd1l1 UTSW 15 44,408,813 (GRCm39) missense probably damaging 1.00
R5809:Pkhd1l1 UTSW 15 44,383,103 (GRCm39) missense probably benign 0.03
R5816:Pkhd1l1 UTSW 15 44,429,718 (GRCm39) missense probably benign 0.01
R5854:Pkhd1l1 UTSW 15 44,445,186 (GRCm39) missense probably damaging 1.00
R5876:Pkhd1l1 UTSW 15 44,441,984 (GRCm39) missense possibly damaging 0.51
R5909:Pkhd1l1 UTSW 15 44,390,159 (GRCm39) missense probably damaging 1.00
R5950:Pkhd1l1 UTSW 15 44,396,361 (GRCm39) missense probably benign 0.00
R5961:Pkhd1l1 UTSW 15 44,322,859 (GRCm39) missense probably damaging 1.00
R5972:Pkhd1l1 UTSW 15 44,408,812 (GRCm39) missense probably damaging 1.00
R5975:Pkhd1l1 UTSW 15 44,389,384 (GRCm39) missense probably damaging 1.00
R5982:Pkhd1l1 UTSW 15 44,352,900 (GRCm39) splice site probably null
R6066:Pkhd1l1 UTSW 15 44,391,525 (GRCm39) missense probably damaging 0.99
R6122:Pkhd1l1 UTSW 15 44,421,336 (GRCm39) missense probably damaging 1.00
R6248:Pkhd1l1 UTSW 15 44,392,955 (GRCm39) missense probably benign
R6294:Pkhd1l1 UTSW 15 44,433,424 (GRCm39) missense probably damaging 1.00
R6301:Pkhd1l1 UTSW 15 44,452,921 (GRCm39) missense probably damaging 0.99
R6526:Pkhd1l1 UTSW 15 44,361,485 (GRCm39) critical splice donor site probably null
R6707:Pkhd1l1 UTSW 15 44,392,539 (GRCm39) missense probably benign
R6736:Pkhd1l1 UTSW 15 44,421,336 (GRCm39) missense probably damaging 1.00
R6753:Pkhd1l1 UTSW 15 44,453,059 (GRCm39) missense probably benign 0.45
R6815:Pkhd1l1 UTSW 15 44,426,051 (GRCm39) missense probably damaging 1.00
R6874:Pkhd1l1 UTSW 15 44,452,923 (GRCm39) missense probably benign 0.06
R6942:Pkhd1l1 UTSW 15 44,386,025 (GRCm39) missense probably damaging 1.00
R6970:Pkhd1l1 UTSW 15 44,375,070 (GRCm39) missense possibly damaging 0.61
R6982:Pkhd1l1 UTSW 15 44,429,664 (GRCm39) missense probably damaging 0.97
R7103:Pkhd1l1 UTSW 15 44,437,027 (GRCm39) missense probably benign 0.02
R7116:Pkhd1l1 UTSW 15 44,421,372 (GRCm39) missense probably benign 0.00
R7135:Pkhd1l1 UTSW 15 44,448,374 (GRCm39) critical splice donor site probably null
R7143:Pkhd1l1 UTSW 15 44,437,033 (GRCm39) missense possibly damaging 0.93
R7177:Pkhd1l1 UTSW 15 44,330,800 (GRCm39) missense probably damaging 1.00
R7194:Pkhd1l1 UTSW 15 44,392,512 (GRCm39) missense probably damaging 1.00
R7204:Pkhd1l1 UTSW 15 44,386,949 (GRCm39) missense possibly damaging 0.90
R7215:Pkhd1l1 UTSW 15 44,391,559 (GRCm39) missense possibly damaging 0.78
R7218:Pkhd1l1 UTSW 15 44,386,091 (GRCm39) missense possibly damaging 0.49
R7225:Pkhd1l1 UTSW 15 44,410,337 (GRCm39) missense probably damaging 1.00
R7283:Pkhd1l1 UTSW 15 44,366,676 (GRCm39) missense probably benign 0.10
R7292:Pkhd1l1 UTSW 15 44,361,986 (GRCm39) missense probably benign
R7304:Pkhd1l1 UTSW 15 44,361,878 (GRCm39) missense possibly damaging 0.94
R7349:Pkhd1l1 UTSW 15 44,378,350 (GRCm39) missense probably damaging 1.00
R7359:Pkhd1l1 UTSW 15 44,452,882 (GRCm39) missense probably damaging 1.00
R7407:Pkhd1l1 UTSW 15 44,458,407 (GRCm39) missense possibly damaging 0.75
R7475:Pkhd1l1 UTSW 15 44,368,581 (GRCm39) nonsense probably null
R7481:Pkhd1l1 UTSW 15 44,376,307 (GRCm39) missense probably benign
R7554:Pkhd1l1 UTSW 15 44,358,866 (GRCm39) missense probably damaging 1.00
R7555:Pkhd1l1 UTSW 15 44,414,157 (GRCm39) missense possibly damaging 0.51
R7562:Pkhd1l1 UTSW 15 44,378,326 (GRCm39) missense possibly damaging 0.68
R7583:Pkhd1l1 UTSW 15 44,431,760 (GRCm39) critical splice donor site probably null
R7595:Pkhd1l1 UTSW 15 44,358,917 (GRCm39) missense probably damaging 1.00
R7749:Pkhd1l1 UTSW 15 44,391,133 (GRCm39) missense probably benign 0.00
R7754:Pkhd1l1 UTSW 15 44,449,804 (GRCm39) missense possibly damaging 0.94
R7761:Pkhd1l1 UTSW 15 44,393,280 (GRCm39) missense probably benign 0.00
R7774:Pkhd1l1 UTSW 15 44,404,303 (GRCm39) missense probably benign 0.03
R7785:Pkhd1l1 UTSW 15 44,406,965 (GRCm39) missense probably damaging 1.00
R7790:Pkhd1l1 UTSW 15 44,441,977 (GRCm39) missense probably damaging 1.00
R7804:Pkhd1l1 UTSW 15 44,460,534 (GRCm39) nonsense probably null
R7864:Pkhd1l1 UTSW 15 44,389,449 (GRCm39) critical splice donor site probably null
R7883:Pkhd1l1 UTSW 15 44,392,522 (GRCm39) missense probably damaging 1.00
R8031:Pkhd1l1 UTSW 15 44,376,230 (GRCm39) missense probably damaging 1.00
R8128:Pkhd1l1 UTSW 15 44,361,449 (GRCm39) missense possibly damaging 0.94
R8142:Pkhd1l1 UTSW 15 44,378,327 (GRCm39) missense probably benign 0.00
R8150:Pkhd1l1 UTSW 15 44,410,055 (GRCm39) missense possibly damaging 0.68
R8209:Pkhd1l1 UTSW 15 44,437,803 (GRCm39) missense possibly damaging 0.46
R8212:Pkhd1l1 UTSW 15 44,362,696 (GRCm39) missense probably benign 0.12
R8226:Pkhd1l1 UTSW 15 44,437,803 (GRCm39) missense possibly damaging 0.46
R8248:Pkhd1l1 UTSW 15 44,406,942 (GRCm39) missense probably damaging 0.99
R8299:Pkhd1l1 UTSW 15 44,445,330 (GRCm39) missense probably benign 0.26
R8425:Pkhd1l1 UTSW 15 44,437,911 (GRCm39) missense probably benign 0.01
R8485:Pkhd1l1 UTSW 15 44,423,796 (GRCm39) missense probably damaging 0.98
R8486:Pkhd1l1 UTSW 15 44,410,812 (GRCm39) missense probably damaging 1.00
R8701:Pkhd1l1 UTSW 15 44,438,079 (GRCm39) missense probably damaging 1.00
R8709:Pkhd1l1 UTSW 15 44,381,570 (GRCm39) missense probably benign 0.01
R8777:Pkhd1l1 UTSW 15 44,361,967 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Pkhd1l1 UTSW 15 44,361,967 (GRCm39) missense probably damaging 1.00
R8845:Pkhd1l1 UTSW 15 44,368,650 (GRCm39) missense probably benign 0.30
R8846:Pkhd1l1 UTSW 15 44,410,358 (GRCm39) nonsense probably null
R8863:Pkhd1l1 UTSW 15 44,433,382 (GRCm39) nonsense probably null
R8917:Pkhd1l1 UTSW 15 44,396,403 (GRCm39) missense probably benign 0.04
R8936:Pkhd1l1 UTSW 15 44,402,312 (GRCm39) missense possibly damaging 0.94
R8962:Pkhd1l1 UTSW 15 44,400,291 (GRCm39) missense probably damaging 1.00
R8971:Pkhd1l1 UTSW 15 44,392,915 (GRCm39) missense possibly damaging 0.68
R8982:Pkhd1l1 UTSW 15 44,387,069 (GRCm39) nonsense probably null
R8994:Pkhd1l1 UTSW 15 44,410,499 (GRCm39) missense probably damaging 0.99
R9004:Pkhd1l1 UTSW 15 44,406,768 (GRCm39) missense probably benign 0.16
R9064:Pkhd1l1 UTSW 15 44,426,038 (GRCm39) missense possibly damaging 0.93
R9173:Pkhd1l1 UTSW 15 44,384,152 (GRCm39) missense probably benign 0.09
R9185:Pkhd1l1 UTSW 15 44,453,019 (GRCm39) missense probably benign 0.01
R9213:Pkhd1l1 UTSW 15 44,358,874 (GRCm39) missense probably damaging 1.00
R9218:Pkhd1l1 UTSW 15 44,384,122 (GRCm39) missense possibly damaging 0.90
R9256:Pkhd1l1 UTSW 15 44,397,290 (GRCm39) critical splice donor site probably null
R9291:Pkhd1l1 UTSW 15 44,433,372 (GRCm39) missense probably damaging 1.00
R9309:Pkhd1l1 UTSW 15 44,400,289 (GRCm39) missense probably benign 0.00
R9319:Pkhd1l1 UTSW 15 44,392,974 (GRCm39) missense possibly damaging 0.46
R9339:Pkhd1l1 UTSW 15 44,452,949 (GRCm39) missense probably damaging 1.00
R9366:Pkhd1l1 UTSW 15 44,410,308 (GRCm39) missense probably benign 0.03
R9444:Pkhd1l1 UTSW 15 44,418,053 (GRCm39) missense probably benign 0.00
R9464:Pkhd1l1 UTSW 15 44,343,009 (GRCm39) missense probably damaging 1.00
R9525:Pkhd1l1 UTSW 15 44,448,322 (GRCm39) missense possibly damaging 0.88
R9542:Pkhd1l1 UTSW 15 44,410,284 (GRCm39) missense probably benign 0.12
R9544:Pkhd1l1 UTSW 15 44,410,239 (GRCm39) missense probably damaging 1.00
R9608:Pkhd1l1 UTSW 15 44,442,029 (GRCm39) missense possibly damaging 0.65
R9673:Pkhd1l1 UTSW 15 44,386,901 (GRCm39) missense probably benign 0.22
R9771:Pkhd1l1 UTSW 15 44,358,883 (GRCm39) missense probably benign
R9792:Pkhd1l1 UTSW 15 44,406,983 (GRCm39) missense probably benign 0.00
R9793:Pkhd1l1 UTSW 15 44,406,983 (GRCm39) missense probably benign 0.00
R9795:Pkhd1l1 UTSW 15 44,406,983 (GRCm39) missense probably benign 0.00
RF006:Pkhd1l1 UTSW 15 44,421,903 (GRCm39) critical splice acceptor site probably benign
RF006:Pkhd1l1 UTSW 15 44,366,634 (GRCm39) missense probably benign 0.03
RF008:Pkhd1l1 UTSW 15 44,421,901 (GRCm39) critical splice acceptor site probably benign
RF012:Pkhd1l1 UTSW 15 44,421,901 (GRCm39) critical splice acceptor site probably benign
RF019:Pkhd1l1 UTSW 15 44,421,903 (GRCm39) critical splice acceptor site probably benign
RF030:Pkhd1l1 UTSW 15 44,421,898 (GRCm39) critical splice acceptor site probably benign
RF033:Pkhd1l1 UTSW 15 44,421,902 (GRCm39) critical splice acceptor site probably benign
RF038:Pkhd1l1 UTSW 15 44,421,899 (GRCm39) critical splice acceptor site probably benign
RF046:Pkhd1l1 UTSW 15 44,421,891 (GRCm39) critical splice acceptor site probably benign
X0027:Pkhd1l1 UTSW 15 44,455,362 (GRCm39) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,441,974 (GRCm39) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,436,972 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCTACTGGGACTTATCACTTAGTGG -3'
(R):5'- ATCTTCATGCACAGGGAGGG -3'

Sequencing Primer
(F):5'- CTACATTAATTGGTTAGATGCAAGCG -3'
(R):5'- ACCACTAGTAAAGATCTTTCAAAGC -3'
Posted On 2021-10-11