Incidental Mutation 'R8973:Adcy8'
ID 683278
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Name adenylate cyclase 8
Synonyms AC8
MMRRC Submission 068807-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R8973 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 64570884-64794145 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 64570984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Glutamine at position 1250 (*1250Q)
Ref Sequence ENSEMBL: ENSMUSP00000023007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
AlphaFold P97490
Predicted Effect probably null
Transcript: ENSMUST00000023007
AA Change: *1250Q
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: *1250Q

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000228014
AA Change: *1220Q
Meta Mutation Damage Score 0.8465 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 A T 13: 70,886,959 (GRCm39) I975N probably benign Het
Anapc1 A T 2: 128,505,952 (GRCm39) I628N probably damaging Het
Ankrd39 C T 1: 36,578,439 (GRCm39) probably benign Het
Ankub1 A T 3: 57,572,932 (GRCm39) S263R possibly damaging Het
Aoah A G 13: 21,024,325 (GRCm39) I94V probably benign Het
Aox1 A G 1: 58,329,113 (GRCm39) D186G probably benign Het
Arap2 A T 5: 62,855,668 (GRCm39) C589* probably null Het
Armt1 T C 10: 4,389,550 (GRCm39) L69P probably damaging Het
Atxn7l3 T A 11: 102,183,598 (GRCm39) Y185F probably benign Het
Cacna2d4 A G 6: 119,218,142 (GRCm39) D159G probably damaging Het
Camta2 C A 11: 70,561,184 (GRCm39) R1184L probably benign Het
Ccdc192 T G 18: 57,725,139 (GRCm39) L123V possibly damaging Het
Ccr7 G A 11: 99,036,649 (GRCm39) T91I probably damaging Het
Cdh9 A G 15: 16,831,131 (GRCm39) T323A possibly damaging Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Clec2e C A 6: 129,070,374 (GRCm39) G216* probably null Het
Col25a1 T C 3: 130,269,275 (GRCm39) S176P unknown Het
Col4a3 A C 1: 82,693,052 (GRCm39) I1446L probably benign Het
Cplane1 T C 15: 8,233,277 (GRCm39) W1201R probably damaging Het
Cse1l A G 2: 166,785,000 (GRCm39) E823G probably damaging Het
Cspg4b A G 13: 113,456,293 (GRCm39) T780A Het
Dchs2 A G 3: 83,261,763 (GRCm39) E2677G possibly damaging Het
Dis3l T C 9: 64,246,824 (GRCm39) E77G probably damaging Het
Dnah6 T C 6: 73,121,734 (GRCm39) D1416G probably benign Het
Dpyd T C 3: 119,108,582 (GRCm39) probably null Het
Dst A G 1: 34,267,936 (GRCm39) D3112G probably damaging Het
Dusp13b A C 14: 21,784,974 (GRCm39) N128K probably benign Het
Emilin2 T G 17: 71,582,079 (GRCm39) K216Q probably benign Het
Enam T C 5: 88,641,947 (GRCm39) W254R possibly damaging Het
Esrrg A C 1: 187,930,947 (GRCm39) N346T possibly damaging Het
Fbn2 C T 18: 58,286,928 (GRCm39) G244R probably damaging Het
Fbxw25 A G 9: 109,479,132 (GRCm39) L373P Het
Gm21060 C A 19: 61,285,366 (GRCm39) V48L possibly damaging Het
Gtpbp3 T C 8: 71,943,806 (GRCm39) V254A possibly damaging Het
H2-DMb2 A G 17: 34,367,699 (GRCm39) D171G probably damaging Het
Hrg A T 16: 22,777,968 (GRCm39) T242S probably benign Het
Inf2 G T 12: 112,573,949 (GRCm39) C751F unknown Het
Krt13 A T 11: 100,010,264 (GRCm39) M239K possibly damaging Het
Lrrc72 A G 12: 36,303,293 (GRCm39) S7P probably benign Het
Matn2 A G 15: 34,433,196 (GRCm39) I867V probably benign Het
Mdh2 C T 5: 135,819,019 (GRCm39) A325V possibly damaging Het
Mki67 C A 7: 135,297,364 (GRCm39) A2557S possibly damaging Het
Mrpl16 A T 19: 11,750,307 (GRCm39) R64* probably null Het
Nav1 T C 1: 135,512,463 (GRCm39) D199G probably benign Het
Nbn T C 4: 15,986,585 (GRCm39) V662A probably damaging Het
Nek10 G A 14: 14,931,321 (GRCm38) probably null Het
Or14a257 A G 7: 86,138,487 (GRCm39) S91P probably damaging Het
Or5t18 C A 2: 86,637,200 (GRCm39) V48F probably benign Het
Or7g12 C A 9: 18,899,974 (GRCm39) S230* probably null Het
Or8b37 T A 9: 37,958,839 (GRCm39) V107D possibly damaging Het
Pcsk7 T G 9: 45,838,940 (GRCm39) S617R probably benign Het
Pde10a C A 17: 9,143,071 (GRCm39) Q6K probably benign Het
Pigq A C 17: 26,151,141 (GRCm39) M396R probably damaging Het
Pkhd1l1 T A 15: 44,449,833 (GRCm39) D3865E probably damaging Het
Prag1 C T 8: 36,566,744 (GRCm39) probably benign Het
Rbis C T 3: 14,672,305 (GRCm39) V97I probably benign Het
Rint1 A G 5: 24,016,728 (GRCm39) T498A probably benign Het
Rnf213 T A 11: 119,352,756 (GRCm39) F3921I Het
Rpp14 A G 14: 8,088,768 (GRCm38) S95G probably benign Het
Ryk T G 9: 102,739,120 (GRCm39) Y78D possibly damaging Het
Sez6 A T 11: 77,865,397 (GRCm39) Q678L probably damaging Het
Slc22a21 T C 11: 53,860,402 (GRCm39) K141E probably damaging Het
Slc30a5 A T 13: 100,943,202 (GRCm39) I609K probably damaging Het
Slc44a4 T C 17: 35,140,538 (GRCm39) F244L probably damaging Het
Spata31e1 A T 13: 49,941,715 (GRCm39) D80E probably benign Het
Susd5 T C 9: 113,911,572 (GRCm39) Y161H possibly damaging Het
Syne3 A G 12: 104,925,654 (GRCm39) probably null Het
Tbcd G C 11: 121,387,679 (GRCm39) probably benign Het
Tektip1 T C 10: 81,199,849 (GRCm39) D129G unknown Het
Tmc1 A T 19: 20,878,215 (GRCm39) N93K probably benign Het
Tmem100 T A 11: 89,926,302 (GRCm39) M43K probably benign Het
Tmem131l A T 3: 83,836,039 (GRCm39) V690D probably damaging Het
Trim8 A G 19: 46,503,903 (GRCm39) Q485R possibly damaging Het
Vmn2r63 A T 7: 42,577,919 (GRCm39) H206Q probably benign Het
Vmn2r77 T A 7: 86,452,150 (GRCm39) N443K possibly damaging Het
Zan T A 5: 137,387,578 (GRCm39) I4878F unknown Het
Zfand4 A G 6: 116,291,041 (GRCm39) D344G probably benign Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64,659,216 (GRCm39) missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64,571,151 (GRCm39) missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64,694,162 (GRCm39) missense probably benign 0.07
IGL01083:Adcy8 APN 15 64,659,191 (GRCm39) missense probably benign 0.21
IGL01296:Adcy8 APN 15 64,655,628 (GRCm39) missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64,609,263 (GRCm39) missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64,687,170 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64,678,511 (GRCm39) missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64,694,069 (GRCm39) missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64,659,303 (GRCm39) missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64,655,833 (GRCm39) missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64,618,744 (GRCm39) critical splice donor site probably null
IGL03180:Adcy8 APN 15 64,655,799 (GRCm39) missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64,792,116 (GRCm39) missense probably damaging 1.00
revolutionary UTSW 15 64,571,236 (GRCm39) missense probably damaging 1.00
whirligig UTSW 15 64,571,134 (GRCm39) missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64,694,083 (GRCm39) missense probably benign 0.38
K7894:Adcy8 UTSW 15 64,694,083 (GRCm39) missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64,626,666 (GRCm39) missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64,571,217 (GRCm39) missense probably benign 0.29
R0119:Adcy8 UTSW 15 64,588,015 (GRCm39) missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64,618,862 (GRCm39) missense probably benign 0.18
R0299:Adcy8 UTSW 15 64,588,015 (GRCm39) missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64,694,044 (GRCm39) missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64,626,711 (GRCm39) missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64,618,780 (GRCm39) missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64,587,911 (GRCm39) missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64,743,625 (GRCm39) missense probably benign 0.25
R1881:Adcy8 UTSW 15 64,678,503 (GRCm39) missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64,639,727 (GRCm39) missense probably benign 0.00
R2014:Adcy8 UTSW 15 64,639,727 (GRCm39) missense probably benign 0.00
R2015:Adcy8 UTSW 15 64,639,727 (GRCm39) missense probably benign 0.00
R2164:Adcy8 UTSW 15 64,792,783 (GRCm39) missense probably benign
R2228:Adcy8 UTSW 15 64,694,056 (GRCm39) missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64,694,056 (GRCm39) missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64,571,230 (GRCm39) missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64,571,008 (GRCm39) missense probably benign 0.10
R3277:Adcy8 UTSW 15 64,571,008 (GRCm39) missense probably benign 0.10
R3404:Adcy8 UTSW 15 64,571,449 (GRCm39) missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64,743,556 (GRCm39) missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64,597,384 (GRCm39) splice site probably benign
R3710:Adcy8 UTSW 15 64,597,384 (GRCm39) splice site probably benign
R3778:Adcy8 UTSW 15 64,618,846 (GRCm39) missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64,597,319 (GRCm39) missense probably benign 0.06
R4685:Adcy8 UTSW 15 64,609,287 (GRCm39) missense probably benign 0.09
R4731:Adcy8 UTSW 15 64,626,711 (GRCm39) missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64,626,711 (GRCm39) missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64,626,711 (GRCm39) missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64,659,207 (GRCm39) missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64,659,207 (GRCm39) missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64,659,207 (GRCm39) missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64,678,553 (GRCm39) missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64,639,706 (GRCm39) missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64,588,001 (GRCm39) missense probably benign 0.04
R5403:Adcy8 UTSW 15 64,588,001 (GRCm39) missense probably benign 0.04
R5521:Adcy8 UTSW 15 64,687,199 (GRCm39) missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64,571,134 (GRCm39) missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64,626,715 (GRCm39) missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64,792,320 (GRCm39) missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64,576,067 (GRCm39) missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64,588,031 (GRCm39) missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64,687,266 (GRCm39) missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64,689,488 (GRCm39) splice site probably null
R6338:Adcy8 UTSW 15 64,792,466 (GRCm39) missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64,571,236 (GRCm39) missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64,609,243 (GRCm39) nonsense probably null
R6636:Adcy8 UTSW 15 64,659,251 (GRCm39) missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64,626,735 (GRCm39) critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64,576,565 (GRCm39) missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64,792,404 (GRCm39) missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64,743,619 (GRCm39) missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64,571,067 (GRCm39) missense probably benign 0.19
R7457:Adcy8 UTSW 15 64,792,529 (GRCm39) missense possibly damaging 0.79
R7611:Adcy8 UTSW 15 64,792,882 (GRCm39) missense probably benign
R7644:Adcy8 UTSW 15 64,571,218 (GRCm39) missense possibly damaging 0.77
R7697:Adcy8 UTSW 15 64,618,850 (GRCm39) missense probably benign
R7735:Adcy8 UTSW 15 64,655,629 (GRCm39) missense probably benign 0.10
R7789:Adcy8 UTSW 15 64,743,623 (GRCm39) nonsense probably null
R7860:Adcy8 UTSW 15 64,571,322 (GRCm39) missense probably damaging 0.97
R7894:Adcy8 UTSW 15 64,792,054 (GRCm39) missense possibly damaging 0.60
R7948:Adcy8 UTSW 15 64,687,199 (GRCm39) missense possibly damaging 0.80
R7966:Adcy8 UTSW 15 64,573,939 (GRCm39) missense probably damaging 1.00
R8024:Adcy8 UTSW 15 64,792,095 (GRCm39) missense probably damaging 1.00
R8097:Adcy8 UTSW 15 64,743,711 (GRCm39) splice site probably null
R8158:Adcy8 UTSW 15 64,655,655 (GRCm39) missense probably benign 0.32
R8463:Adcy8 UTSW 15 64,792,874 (GRCm39) missense probably benign
R8474:Adcy8 UTSW 15 64,576,638 (GRCm39) missense probably damaging 0.98
R8696:Adcy8 UTSW 15 64,687,235 (GRCm39) missense probably benign 0.30
R8955:Adcy8 UTSW 15 64,576,554 (GRCm39) missense possibly damaging 0.92
R9015:Adcy8 UTSW 15 64,597,206 (GRCm39) intron probably benign
R9041:Adcy8 UTSW 15 64,609,287 (GRCm39) missense probably benign 0.31
R9052:Adcy8 UTSW 15 64,792,764 (GRCm39) missense probably benign 0.00
R9074:Adcy8 UTSW 15 64,573,940 (GRCm39) missense probably damaging 0.96
R9183:Adcy8 UTSW 15 64,694,116 (GRCm39) missense probably damaging 0.98
R9259:Adcy8 UTSW 15 64,576,604 (GRCm39) missense probably damaging 1.00
R9498:Adcy8 UTSW 15 64,792,045 (GRCm39) missense possibly damaging 0.88
R9522:Adcy8 UTSW 15 64,792,560 (GRCm39) missense probably damaging 0.99
R9800:Adcy8 UTSW 15 64,571,095 (GRCm39) missense probably benign 0.19
Z1176:Adcy8 UTSW 15 64,597,367 (GRCm39) missense probably benign 0.16
Z1177:Adcy8 UTSW 15 64,571,026 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACTTTTGGCCTCATAGATCTTG -3'
(R):5'- AATACTCTCTGGCTGCGGTTG -3'

Sequencing Primer
(F):5'- GCCTCATAGATCTTGTGTATAGGAAG -3'
(R):5'- GTTGTCCTTGGCCTTGTCCAG -3'
Posted On 2021-10-11